Molecule Information

General Information of the Molecule (ID: Mol01382)

• Name: hsa-mir-34a ,Homo sapiens
• Synonyms: microRNA 34a
• Molecule Type: Precursor miRNA
• Gene Name: MIR34A
• Gene ID: 407040
• Location: chr1:9151668-9151777[-]
• Sequence:
  GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGG
  AAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC
• Ensembl ID: ENSG00000284357
• HGNC ID: HGNC:31635
• Precursor Accession: MI0000268

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 20 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [2]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR-34a/Sirt1/E2F3; Regulation; N.A.
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: Array hybridization assay; qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MiR-34a was identified as one of the down-regulated micro-RNAs (miRs) in human colorectal cancer 5-fluorouracil (5-FU)-resistant DLD-1 cells compared with those in the parental DLD-1 cells

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [ICD-11: 2D02.2] [3]

• Resistant Disease: Retinoblastoma [ICD-11: 2D02.2]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAGE-A/p53 signaling; Regulation; N.A.
• In Vitro Model: HXO-Rb44 cells; Retina; Homo sapiens (Human); CVCL_D542
• In Vitro Model: SO-Rb50 cells; Retina; Homo sapiens (Human); CVCL_D543
• In Vitro Model: Y79 cells; Retina; Homo sapiens (Human); CVCL_1893
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: Reverse transcription-quantitative polymerase chain reaction
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The results indicated that SO-Rb50 cells exhibited the highest resistance to carboplatin, Adriamycin and vincristine (P<0.05), whereas HXO-Rb44 cells revealed the highest inhibition rate in response to etoposide (P<0.05) out of the four cell lines. Furthermore, reduced miR-34a expression and increased MAGE-A expression significantly elevated the survival rate and viability of SO-Rb50 cells following drug treatment (all P<0.05). miR-34a was also demonstrated to directly target MAGE-A, thereby significantly promoting the viability of RB cells and depressing apoptosis (P<0.05). p53, which was subjected to modulation by miR-34a and MAGE-A, also significantly reduced the proliferation rate of RB cells (P<0.05). In conclusion, the miR-34a/MAGE-A/p53 axis may be conducive to enhancing the efficacies of chemotherapeutic treatments for RB.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [4]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR-34a/Sirt1/E2F3; Regulation; N.A.
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: Array hybridization assay; qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Recent studies have established miR-34a as a key effector of the p53 signaling pathway and have implicated its role in multiple cancer types

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual luciferase assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [6]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR; Northern blot analysis
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Results were particularly robust for miR-34a, which appeared associated with either event-free or overall survival and emerged as a significant predictor also after multivariate analysis

Epirubicin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Epirubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BIU87 cells; Bladder; Homo sapiens (Human); CVCL_6881
• In Vitro Model: BIU87 cells; Bladder; Homo sapiens (Human); CVCL_6881
• In Vivo Model: Bladder cancer patients; Nude mouse xenograft model; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual-luciferase reporter assay
• Experiment for Drug Resistance: Cell viability assay; Clone formation assay; Cell cycle assay; Apoptosis assay; Wound healing assay; Transwell cell invasion assay
• Mechanism Description: Moreover, it was found that miR-34a increased the sensitivity of BIU87/ADR cells to chemotherapy in vivo. The luciferase reporter assay ascertained that TCF1 and LEF1 are direct target genes of miR-34a. It was found that miR-34a increased chemosensitivity in BIU87/ADR cells by inhibiting the TCF1/LEF1 axis.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [7]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HN5 cells; Neck; Homo sapiens (Human); CVCL_8128
• Experiment for Molecule Alteration: qPCR; Western blot; Phospho-RTK array; Microarray Analysis
• Experiment for Drug Resistance: Drug sensitivity and cell viability assays
• Mechanism Description: Expression of the tumor suppressor miR-34a was reduced in HN5-ER cells and increasing its expression abrogated Axl expression and reversed erlotinib resistance

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [ICD-11: 2D02.2] [3]

• Resistant Disease: Retinoblastoma [ICD-11: 2D02.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAGE-A/p53 signaling; Regulation; N.A.
• In Vitro Model: HXO-Rb44 cells; Retina; Homo sapiens (Human); CVCL_D542
• In Vitro Model: SO-Rb50 cells; Retina; Homo sapiens (Human); CVCL_D543
• In Vitro Model: Y79 cells; Retina; Homo sapiens (Human); CVCL_1893
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: Reverse transcription-quantitative polymerase chain reaction
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The results indicated that SO-Rb50 cells exhibited the highest resistance to carboplatin, Adriamycin and vincristine (P<0.05), whereas HXO-Rb44 cells revealed the highest inhibition rate in response to etoposide (P<0.05) out of the four cell lines. Furthermore, reduced miR-34a expression and increased MAGE-A expression significantly elevated the survival rate and viability of SO-Rb50 cells following drug treatment (all P<0.05). miR-34a was also demonstrated to directly target MAGE-A, thereby significantly promoting the viability of RB cells and depressing apoptosis (P<0.05). p53, which was subjected to modulation by miR-34a and MAGE-A, also significantly reduced the proliferation rate of RB cells (P<0.05). In conclusion, the miR-34a/MAGE-A/p53 axis may be conducive to enhancing the efficacies of chemotherapeutic treatments for RB.

Gefitinib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [8]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: HGF-mediated signaling; Regulation; N.A.
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-8 test
• Mechanism Description: We found that the forced expression of miR-34a inhibited cell growth and induced apoptosis partly by targeting MET in HGF-induced gefitinib-resistant HCC827 and PC-9 cells. MiR-34a down-regulated the expression of MET and inhibited downstream pathways in HGF-mediated gefitinib-resistant HCC827 and PC-9 cells

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [1]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay; MTT assay
• Mechanism Description: The present study identifies a series of miRNAs which were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. Upregulation of expression of gene hsa-mir-34a

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [4]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR-34a/Sirt1/E2F3; Regulation; N.A.
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: Array hybridization assay; qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Recent studies have established miR-34a as a key effector of the p53 signaling pathway and have implicated its role in multiple cancer types

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [3]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: OAZ2 Signaling; Regulation; N.A.
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: SW-480 cells; Colon; Homo sapiens (Human); CVCL_0546
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: Here, we report for the first time that miR-34a expression was significantly downregulated in clinical CCa samples from oxaliplatin-resistant patients and in experimentally established multidrug-resistant CCa cells. By using histoculture drug response assay, we further confirmed that clinical CCa samples with lower miR-34a expression appeared to be more resistant to chemotherapy. Functionally, ectopic expression of exogenous miR-34a resensitized multidrug-resistant HCT-8/OR cells to oxaliplatin treatment, whereas miR-34a inhibition augmented the oxaliplatin resistance in chemosensitive HCT-8 cells. Mechanistically, miR-34a positively regulated the mRNA stability of the ornithine decarboxylase antizyme 2 (OAZ2) by directly targeting its three prime untranslated region (3'UTR). Consequently, suppression of the expression of miR-34a/OAZ2 signaling by chemotherapeutic agents significantly enhanced the activation of MDR-associated ATP-binding cassette (ABC) transporters and antiapoptosis pathways, thus leading to MDR development in CCa cells. Collectively, our combined analysis reveals a critical role of miR-34a/OAZ2 cascade in conferring a proper cellular response to CCa chemotherapy.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot
• Experiment for Drug Resistance: Apoptosis Assay; Cell Viability Assay
• Mechanism Description: In addition, whereas all 12 of these miRNAs reduced MCL1 protein expression, only 10 of them targeted MCL1 through direct binding to the 3'-untranslated region of the gene, raising the possibility that other resistance regulators of MCL1 expression may be identified using our method.

Sorafenib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [10]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vivo Model: Liver tissues model; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; Immunohistochemistry; Western blot; Luciferase Reporter Assay
• Experiment for Drug Resistance: Cell Proliferation Assay
• Mechanism Description: In this study, we confirmed that miR-34a was significantly down-regulated in HCC tissues and HCC cell lines by qRT-PCR. HCC tissues with lower miR-34a expression displayed higher expression of Bcl-2 protein than those with high expression of miR-34a; therefore, an inverse correlation is evident between the miR-34a level and Bcl-2 expression. Moreover, patients with lower miR-34a expression had significantly poorer overall survival. Bioinformatics and luciferase reporter assays revealed that miR-34a binds the 3'-UTR of the Bcl-2 mRNA and represses its translation. Western blotting analysis and qRT-PCR confirmed that Bcl-2 is inhibited by miR-34a overexpression. Functional analyses indicated that the restoration of miR-34a reduced cell viability, promoted cell apoptosis and potentiated sorafenib-induced apoptosis and toxicity in HCC cell lines by inhibiting Bcl-2 expression. This study is the first to demonstrate that miR-34a induces sensitivity to the anti-tumor effect of sorafenib in human HCC cells, suggesting a potential role of miR-34a in the treatment of HCC.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [10]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Temozolomide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [11]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MET/MAPK pathway; Regulation; N.A.
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Scratch assay; Flow cytometry; Cell cycle assay
• Mechanism Description: hsa-miR-34a-5p downregulated RAF1 expression, as the signaling factor of the MAPK pathway. The combined treatment significantly downregulated the expression of MET, SRC, and MAP2K1, leading to the inhibition of the MET/MAPK pathway compared to temozolomide. Besides exerting anti-tumoral effects on the cell viability, migration, cell cycle, apoptosis, and clonogenicity of A172 cells, its combination with temozolomide enhanced temozolomide anti-tumoral effect. Compared to temozolomide, the combined treatment significantly decreased CDK4, CDK6, CCND1, and MMP2 expression. hsa-miR-34a-5p targets RAF1, as the signaling factor of the MAPK pathway, and potentiates the temozolomide anti-tumoral effect on A172 cells.

Vemurafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [ICD-11: 2C30.0] [12]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Vemurafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Melanoma patients; Homo sapiens
• Experiment for Molecule Alteration: Microarray profiling; Immunostaining; qRT-PCR
• Experiment for Drug Resistance: MTT colorimetric assays
• Mechanism Description: Vemurafenib treatment increased the CCL2 levels in plasma, whereas the long-term clinical response was associated with low CCL2 levels.Increased CCL2 production was associated with miRNA deregulation in the resistant cells. miR-34a, miR-100 and miR-125b showed high expression in both resistant cells and in tumor biopsies that were obtained from treated patients, and they were involved in the control of cell proliferation and apoptosis. Inhibition of CCL2 and of the selected miRNAs restored both the cell apoptosis and the drug efficacy in resistant melanoma cells.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [13]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [6]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR; Northern blot analysis; Immunoprecipitation; Luciferase assays
• Experiment for Drug Resistance: Flow cytometry assay; Chemosensitivity assays
• Mechanism Description: Results were particularly robust for miR-34a, which appeared associated with either event-free or overall survival and emerged as a significant predictor also after multivariate analysis

Clinical Trial Drug(s) 1 drug(s) in total

Camptothecin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [14]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Camptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53/miR-34a/SIRT1 pathway; Regulation; N.A.
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: RT-PCR; Western blot; Transfection and reporter assays
• Experiment for Drug Resistance: Cell cycle analysis; trypan blue exclusion assay
• Mechanism Description: Ectopic miR-34a expression resulted in cell cycle arrest and growth inhibition and attenuated chemoresistance to anticancer drug camptothecin by inducing apoptosis, suggesting a potential role of miR-34a for the treatment of p53-defective prostate cancer.

References

• Ref 1: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 2: Dysregulation of microRNA-34a expression causes drug-resistance to 5-FU in human colon cancer DLD-1 cells. Cancer Lett. 2011 Jan 28;300(2):197-204. doi: 10.1016/j.canlet.2010.10.006. Epub 2010 Nov 9.
• Ref 3: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 4: miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75. doi: 10.1093/neuonc/noq179. Epub 2010 Dec 22.
• Ref 5: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 6: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 7: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 8: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 9: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 10: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 11: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 12: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.
• Ref 13: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 14: Effects of miR-34a on cell growth and chemoresistance in prostate cancer PC3 cells. Biochem Biophys Res Commun. 2008 Dec 5;377(1):114-9. doi: 10.1016/j.bbrc.2008.09.086. Epub 2008 Oct 1.