Molecule Information
General Information of the Molecule (ID: Mol01383)
Name |
hsa-mir-181a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 181a-2
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR181A2
|
||||
Gene ID | |||||
Location |
chr9:124692442-124692551[+]
|
||||
Sequence |
AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAG
UUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
14 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Carboplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical squamous cell carcinoma | [2] | |||
Resistant Disease | Cervical squamous cell carcinoma [ICD-11: 2C77.3] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
ME-180 cells | Uterus | Homo sapiens (Human) | CVCL_1401 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The down-regulation of PRkCD expression may be a molecular mechanism through which miR-181a exerts its functions as an oncogene and an enhancer of chemoresistance to cisplatin in cervical squamous cell carcinoma cells. | |||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [3] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | SGC7901/CDDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | miR-181a inhibited autophagy in cisplatin-resistant cell line SGC7901/CDDP. ATG5 was a potential target of miR-181a. miR-181a sensitized SGC7901/CDDP cells to cisplatin in vivo and in vitro. | |||
|
||||
Disease Class: Tongue squamous cell carcinoma | [4] | |||
Sensitive Disease | Tongue squamous cell carcinoma [ICD-11: 2B62.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
miR181a-Twist1 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | CAL27 cells | Oral | Homo sapiens (Human) | CVCL_1107 |
SCC15 cells | Tongue | Homo sapiens (Human) | CVCL_1681 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Cisplatin chemoresistance induced EMT, enhanced metastatic potential and down-regulated miR-181a in TSCC cells, miR-181a directly targeted Twist1 and then reversed chemoresistance and EMT in TSCC cells, miR-181a-Twist1 pathway may play an important role in the development of cisplatin-chemoresistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Leukemia | [5] | |||
Sensitive Disease | Leukemia [ICD-11: 2B33.6] | |||
Sensitive Drug | Cytarabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
HL-60/Ara-C-resistant cells | Blood | Homo sapiens (Human) | CVCL_1736 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Bcl-2 was conWrmed as adirect miR-181a target by immunoblot analysis andreporter gene assays. knockdown of Bcl-2 mimicked theeVect of enforced miR-181a expression by reducing cellviability. In addition, the apoptosis pathway was activated by cytochrome C release and caspase 9/caspase 3 activationafter miR-181a overexpression. Down-regulation of miR-181a and upregulation of Bcl-2in leukaemia cells confer resistance to Ara-C-based ther-apy. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Leukemia | [6] | |||
Sensitive Disease | Leukemia [ICD-11: 2B33.6] | |||
Sensitive Drug | Daunorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
K562/A02 cells | Blood | Homo sapiens (Human) | CVCL_0368 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Anti-apoptotic BCL-2 contributes to the survival and chemoresistance of quiescent leukemia CD34+ cells, leukemia cells with decreased miR-181a expression and elevated BCL-2 protein expression were more resistant to DNR than the control cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [7] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | C4-2B cells | Prostate | Homo sapiens (Human) | CVCL_4784 |
TaxR cells | Prostate | Homo sapiens (Human) | CVCL_4V97 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Beckman Coulter method; Rhodamine Assay; Cell Death ELISA | |||
Mechanism Description | Overexpression of miR181a in prostate cancer cells contributes to their resistance to docetaxel, this is due, in part, to modulation of p53 phosphorylation and apoptosis. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [8] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-181a played an important role in chemosensitivity to adriamycin in MCF-7 and MCF-7/ADR cells via targeting Bcl-2. | |||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Chronic lymphocytic leukemia | [9] | |||
Resistant Disease | Chronic lymphocytic leukemia [ICD-11: 2A82.0] | |||
Resistant Drug | Fludarabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | p53 signaling pathway | Inhibition | hsa04115 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | High levels of miR-181a and miR-221 also point to cell cycle progression as both miRNAs repress CDkN1B (p27) expression in hematologic diseases and p27 was also found down-regulated in resistant cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Chronic lymphocytic leukemia | [10] | |||
Sensitive Disease | Chronic lymphocytic leukemia [ICD-11: 2A82.0] | |||
Sensitive Drug | Fludarabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | CLL B cells | Lymph | Homo sapiens (Human) | N.A. |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR-181a and miR-181b directly inhibit the expression of BCL-2, MCL-1 and XIAP by binding to the target sequence, sensitizes CLL cells to fludarabine-induced apoptosis. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [11] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | AKT/ERK signaling pathway | Regulation | hsa04010 | |
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
PC9GR cells | Lung | Homo sapiens (Human) | CVCL_V337 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Down-regulation of GAS7 expression could antagonize gefitinib re-sensitivity in PC9GR mediated by knockdown of miR181a via AkT/ERk pathways and epithelial-to-mesenchymal transition markers. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Mitomycin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [12] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Mitoxantrone | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
Cell viability | Activation | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of miR-181a down-regulated BCRP expression, and sensitized MX-resistant MCF-7/MX cells to MX. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [13] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-181a level in chemoresistant (CR) cancer tissues were significantly higher than in chemosensitive (CS) cancer tissues and in normal tissue. SkOV3/PTX cells had significantly higher expression of miR-181a and N-cadherin than SkOV3 cells. SkOV3 cells had decreased E-cadherin expression and increased N-cadherin expression after enforced miR-181a expression, while SkOV3/PTX cells had increased E-cadherin expression and decreased N-cadherin expression after miR-181a knockdown. SkOV3 cells had increased P-gp expression after enforced miR-181a expression. Following MTT assay and flow cytometry analysis both confirmed that miR-181a overexpression decreased the PTX sensitivity of SkOV3 cells and while miR-181a inhibition increased the sensitivity of SkOV3/PTX cells. miR-181a is an important oncomiR significantly increased in chemoresistant ovarian cancer. Its upregulation is associated with increased level of EMT and decreased cell apoptosis induced by PTX treatment. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Nasopharyngeal carcinoma | [14] | |||
Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | CCAT1/miR181a/CPEB2 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | CNE2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6889 |
CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | LncRNA CCAT1 regulates the sensitivity of paclitaxel in NPC cells via miR181a/CPEB2 axis. miR181a restores CCAT1-induced paclitaxel resistant in NPC cells via targeting CPEB2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [15] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Sorafenib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
MAPK signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Caspase 3/7 activity analysis; CCK8 assay | |||
Mechanism Description | miR-181a induces sorafenib resistance of hepatocellular carcinoma cells through downregulation of RASSF1 expression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Malignant glioma | [16] | |||
Resistant Disease | Malignant glioma [ICD-11: 2A00.2] | |||
Resistant Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
SNB19 cells | Brain | Homo sapiens (Human) | CVCL_0535 | |
U373 cells | Brain | Homo sapiens (Human) | CVCL_2219 | |
U118 cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
NHA cells | Brain | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; BrdU incorporation assay | |||
Mechanism Description | LncRNA CASC2 interacts with miR181a to modulate glioma growth and resistance to TMZ through PTEN pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioma | [16] | |||
Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PTEN signaling pathway | Activation | hsa05235 | |
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
SNB19 cells | Brain | Homo sapiens (Human) | CVCL_0535 | |
U373 cells | Brain | Homo sapiens (Human) | CVCL_2219 | |
U118 cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
NHA cells | Brain | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; BrdU incorporation assay | |||
Mechanism Description | CASC2 up-regulated PTEN protein and down-regulated p-AkT protein through regulating miR181a, and the effect of CASC2 on PTEN and p-AkT could be partially restored by miR181a. | |||
Disease Class: Glioblastoma | [17] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Clinical Trial Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Paediatric acute lymphocytic leukemia | [18] | |||
Sensitive Disease | Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | |||
Sensitive Drug | Camptothecin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | CCRF-CEM cells | Pleural effusion | Homo sapiens (Human) | CVCL_0207 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Abnormal high expression of miR-181a in bone marrow and Cim-C1 cells in ALL children, inhibition of Mir-181A expression in Cim-C1 cells can significantly increase drug sensitivity of CIM-C1 cells, and upregulation of Mir-181A expression in CCRF-CEM cells can significantly increase drug resistance of CCRF-CEM cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder carcinoma | [19] | |||
Resistant Disease | Bladder carcinoma [ICD-11: 2C94.1] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. | |||
Disease Class: Adult acute myeloid leukemia | [19] | |||
Resistant Disease | Adult acute myeloid leukemia [ICD-11: 2A60.1] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. | |||
Disease Class: Colon carcinoma | [19] | |||
Resistant Disease | Colon carcinoma [ICD-11: 2B90.2] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. | |||
Disease Class: Prostate cancer | [19] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | C4-2B cells | Prostate | Homo sapiens (Human) | CVCL_4784 |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. |
Investigative Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [20] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Platinum | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell migration | Inhibition | hsa04670 | ||
TGF-beta signaling pathway | Activation | hsa04350 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Clonogenicity assay; Cell migration and invasion assay | |||
Mechanism Description | Smad7 is a direct functional target of miR-181a. There is a striking inverse correlation between miR-181a and Smad7 expression. enhanced miR-181a expression resulted in the activation of other Smad-dependent protein such as TGF-beta R1 and potentially non-canonical TGF-beta-related pathways. By this mechanism the TGF-beta pathway is activated in ovarian cancer tumours and contributes to poor patient outcome. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.