Molecule Information
General Information of the Molecule (ID: Mol01412)
| Name |
hsa-mir-27b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 27b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR27B
|
||||
| Gene ID | |||||
| Location |
chr9:95085445-95085541[+]
|
||||
| Sequence |
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUG
UUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
17 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Carboplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| SGC-7901/FU cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis assay | |||
| Mechanism Description | LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
|
|
||||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [3] | |||
| Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | TE10 cells | Esophagus | Homo sapiens (Human) | CVCL_1760 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-27 in serum originated mainly from esophageal cancer cells, because its serum expression level in patients with esophageal cancer was significantly higher than that of healthy volunteers and decreased significantly after surgery compared with the baseline (before surgery). Moreover, co-culture of fibroblasts with anti-miR-27-transfected esophageal cancer cells resulted in a major decrease in the antiapoptotic function of fibroblasts, compared with fibroblasts co-cultured with control esophageal cancer cells that secrete extracellular miR-27. Serum miR-27 level may reflect the expression level of extracellular miR-27 derived from esophageal cancer cells. miR-27 is involved in resistance to chemotherapy in esophageal cancer, through miR-27 -induced transformation of NOF into CAF, and that TGF-beta secreted from these CAF-like fibroblasts induces chemoresistance to cisplatin in esophageal cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] | [4] | |||
| Sensitive Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| FZD7/beta-catenin signaling pathway | Activation | hsa05224 | ||
| In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | miR-27b can increase the sensitivity of OSCC cells to cisplatin drugs, significantly inhibit OSCC cell proliferation, promote cell apoptosis, and inhibit cell invasion and migration, which may be related to the inhibition of FDZ7/beta-catenin signaling pathway by miR-27b. | |||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [5] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon carcinoma [ICD-11: 2B90.2] | [6] | |||
| Resistant Disease | Colon carcinoma [ICD-11: 2B90.2] | |||
| Resistant Drug | Cyclophosphamide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | LS-180 cells | Colon | Homo sapiens (Human) | CVCL_0397 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Sulforhodamine B assay | |||
| Mechanism Description | CYP3A4 is the most abundant hepatic and intestinal cytochrome P450 enzyme in humans, contributing to the metabolism of various drugs such as benzodiazepines, HIV antivirals, macrolide antibiotics, and statins. CYP3A4 3'UTR-luciferase activity was significantly decreased in human embryonic kidney 293 cells transfected with plasmid that expressed microRNA-27b (miR-27b) or mouse microRNA-298 (mmu-miR-298), overexpression of miR-27b or mmu-miR-298 in PANC1 cells led to a lower sensitivity to cyclophosphamide. | |||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [6] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Cyclophosphamide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Panc1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Sulforhodamine B assay | |||
| Mechanism Description | CYP3A4 is the most abundant hepatic and intestinal cytochrome P450 enzyme in humans, contributing to the metabolism of various drugs such as benzodiazepines, HIV antivirals, macrolide antibiotics, and statins. CYP3A4 3'UTR-luciferase activity was significantly decreased in human embryonic kidney 293 cells transfected with plasmid that expressed microRNA-27b (miR-27b) or mouse microRNA-298 (mmu-miR-298), overexpression of miR-27b or mmu-miR-298 in PANC1 cells led to a lower sensitivity to cyclophosphamide. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [7] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| EGFR signaling pathway | Inhibition | hsa01521 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The transfection of miR 27b mimics led to downregulation of the expression levels of EGFR, whilst miR 27b inhibitors upregulated the expression levels of EGFR. Furthermore, it was demonstrated that the transfection of miR 27b mimics significantly suppressed the apoptosis and promote the viability of A549 human lung carcinoma cells. In line with this, the introduction of miR 27b inhibitors significantly induced apoptosis and inhibited the proliferation of A549 cells. These results indicate that miR 27b may promote NSCLC cell viability and enhance resistance to docetaxel treatment through direct inhibition of EGFR expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [8] | |||
| Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
| PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
| PrEC cells | Prostate | Homo sapiens (Human) | CVCL_0061 | |
| HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR27b and miR34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| SGC-7901/FU cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis assay | |||
| Mechanism Description | LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [5] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Epirubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [5] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Epirubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [5] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| SGC-7901/FU cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis assay | |||
| Mechanism Description | LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [5] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [9] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Caspase-3 activity assay | |||
| Mechanism Description | Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [10] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| Experiment for Molecule Alteration |
qRT-PCR; Microarrays assay; Gene expression levels analysis | |||
| Experiment for Drug Resistance |
Apoptosis assay; Cell viability assay | |||
| Mechanism Description | MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Mitomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [11] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Mechanism Description | In this study, we identified the changes in 14 miRNAs in 5-fluouracil and 40 miRNAs in oxaliplatin-resistant cell lines by miRNA sequencing. The decrease in miR-224-5p expression in the 5-fluorouracil-resistant cells correlated with drug insensitivity due to its overexpression-induced drug-dependent apoptosis. On the other hand, the miR-23b/27b/24-1 cluster was overexpressed in oxaliplatin-resistant cells. The knockout of miR-23b led to the partial restoration of oxaliplatin susceptibility, showing the essential role of miR-23b in the development of drug resistance by this cluster. Proteomic analysis identified target genes of miR-23b and showed that endothelial-mesenchymal transition (EMT) was implicated in oxaliplatin insensibility. Data revealed that EMT markers, such as vimentin and SNAI2, were expressed moderately higher in the oxaliplatin-resistant cells and their expression increased further in the less drug-resistant cells, which had miR-23b knockout. This establishes that the balance of EMT contributes to the drug resistance, showing the importance of the miR-23b-mediated fine-tuning of EMT in oxaliplatin-resistant cancer cells. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] | [12] | |||
| Sensitive Disease | Laryngeal carcinoma [ICD-11: 2C23.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
Microarray analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | The possible mechanism by which ER-associated genes mediate paclitaxel sensitivity is in that ER is associated with the microtubule cytoskeleton, exactly site where paclitaxel exerts its cytotoxic effect in cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [5] | |||
| Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [5] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | N.A. | |
| In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [13] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Transwell assay; Promega assay | |||
| Mechanism Description | miR-27b is epigenetically downregulated in tamoxifen resistant breast cancer cells due to promoter methylation and regulates tamoxifen sensitivity by targeting HMGB3. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
