General Information of the Molecule (ID: Mol01412)
Name
hsa-mir-27b ,Homo sapiens
Synonyms
microRNA 27b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR27B
Gene ID
407019
Location
chr9:95085445-95085541[+]
Sequence
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUG
UUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG
    Click to Show/Hide
Ensembl ID
ENSG00000207864
HGNC ID
HGNC:31614
Precursor Accession
MI0000440
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
17 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Carboplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/FU cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC Apoptosis assay
Mechanism Description LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [3]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model TE10 cells Esophagus Homo sapiens (Human) CVCL_1760
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-27 in serum originated mainly from esophageal cancer cells, because its serum expression level in patients with esophageal cancer was significantly higher than that of healthy volunteers and decreased significantly after surgery compared with the baseline (before surgery). Moreover, co-culture of fibroblasts with anti-miR-27-transfected esophageal cancer cells resulted in a major decrease in the antiapoptotic function of fibroblasts, compared with fibroblasts co-cultured with control esophageal cancer cells that secrete extracellular miR-27. Serum miR-27 level may reflect the expression level of extracellular miR-27 derived from esophageal cancer cells. miR-27 is involved in resistance to chemotherapy in esophageal cancer, through miR-27 -induced transformation of NOF into CAF, and that TGF-beta secreted from these CAF-like fibroblasts induces chemoresistance to cisplatin in esophageal cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [4]
Sensitive Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
FZD7/beta-catenin signaling pathway Activation hsa05224
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Colony formation assay; Flow cytometry assay
Mechanism Description miR-27b can increase the sensitivity of OSCC cells to cisplatin drugs, significantly inhibit OSCC cell proliferation, promote cell apoptosis, and inhibit cell invasion and migration, which may be related to the inhibition of FDZ7/beta-catenin signaling pathway by miR-27b.
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Sensitive Disease Liver cancer [ICD-11: 2C12.6]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model 769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Cyclophosphamide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon carcinoma [ICD-11: 2B90.2] [6]
Resistant Disease Colon carcinoma [ICD-11: 2B90.2]
Resistant Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model LS-180 cells Colon Homo sapiens (Human) CVCL_0397
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Sulforhodamine B assay
Mechanism Description CYP3A4 is the most abundant hepatic and intestinal cytochrome P450 enzyme in humans, contributing to the metabolism of various drugs such as benzodiazepines, HIV antivirals, macrolide antibiotics, and statins. CYP3A4 3'UTR-luciferase activity was significantly decreased in human embryonic kidney 293 cells transfected with plasmid that expressed microRNA-27b (miR-27b) or mouse microRNA-298 (mmu-miR-298), overexpression of miR-27b or mmu-miR-298 in PANC1 cells led to a lower sensitivity to cyclophosphamide.
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [6]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Panc1 cells Pancreas Homo sapiens (Human) CVCL_0480
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Sulforhodamine B assay
Mechanism Description CYP3A4 is the most abundant hepatic and intestinal cytochrome P450 enzyme in humans, contributing to the metabolism of various drugs such as benzodiazepines, HIV antivirals, macrolide antibiotics, and statins. CYP3A4 3'UTR-luciferase activity was significantly decreased in human embryonic kidney 293 cells transfected with plasmid that expressed microRNA-27b (miR-27b) or mouse microRNA-298 (mmu-miR-298), overexpression of miR-27b or mmu-miR-298 in PANC1 cells led to a lower sensitivity to cyclophosphamide.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [7]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
EGFR signaling pathway Inhibition hsa01521
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description The transfection of miR 27b mimics led to downregulation of the expression levels of EGFR, whilst miR 27b inhibitors upregulated the expression levels of EGFR. Furthermore, it was demonstrated that the transfection of miR 27b mimics significantly suppressed the apoptosis and promote the viability of A549 human lung carcinoma cells. In line with this, the introduction of miR 27b inhibitors significantly induced apoptosis and inhibited the proliferation of A549 cells. These results indicate that miR 27b may promote NSCLC cell viability and enhance resistance to docetaxel treatment through direct inhibition of EGFR expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [8]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
PrEC cells Prostate Homo sapiens (Human) CVCL_0061
HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR27b and miR34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/FU cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC Apoptosis assay
Mechanism Description LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Sensitive Disease Liver cancer [ICD-11: 2C12.6]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model 769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Epirubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Sensitive Disease Liver cancer [ICD-11: 2C12.6]
Sensitive Drug Epirubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Epirubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model 769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Sensitive Disease Liver cancer [ICD-11: 2C12.6]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model 769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/FU cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC Apoptosis assay
Mechanism Description LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Sensitive Disease Liver cancer [ICD-11: 2C12.6]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model 769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [9]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Caspase-3 activity assay
Mechanism Description Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [10]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
Experiment for
Molecule Alteration
qRT-PCR; Microarrays assay; Gene expression levels analysis
Experiment for
Drug Resistance
Apoptosis assay; Cell viability assay
Mechanism Description MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria.
Mitomycin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Mitomycin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [11]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
RT-qPCR
Mechanism Description In this study, we identified the changes in 14 miRNAs in 5-fluouracil and 40 miRNAs in oxaliplatin-resistant cell lines by miRNA sequencing. The decrease in miR-224-5p expression in the 5-fluorouracil-resistant cells correlated with drug insensitivity due to its overexpression-induced drug-dependent apoptosis. On the other hand, the miR-23b/27b/24-1 cluster was overexpressed in oxaliplatin-resistant cells. The knockout of miR-23b led to the partial restoration of oxaliplatin susceptibility, showing the essential role of miR-23b in the development of drug resistance by this cluster. Proteomic analysis identified target genes of miR-23b and showed that endothelial-mesenchymal transition (EMT) was implicated in oxaliplatin insensibility. Data revealed that EMT markers, such as vimentin and SNAI2, were expressed moderately higher in the oxaliplatin-resistant cells and their expression increased further in the less drug-resistant cells, which had miR-23b knockout. This establishes that the balance of EMT contributes to the drug resistance, showing the importance of the miR-23b-mediated fine-tuning of EMT in oxaliplatin-resistant cancer cells.
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] [12]
Sensitive Disease Laryngeal carcinoma [ICD-11: 2C23.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Microarray analysis; qRT-PCR
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description The possible mechanism by which ER-associated genes mediate paclitaxel sensitivity is in that ER is associated with the microtubule cytoskeleton, exactly site where paclitaxel exerts its cytotoxic effect in cancer cells.
Sorafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [5]
Sensitive Disease Liver cancer [ICD-11: 2C12.6]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR27b/CCNG1/p53 signaling pathway Regulation N.A.
In Vitro Model 769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [13]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Transwell assay; Promega assay
Mechanism Description miR-27b is epigenetically downregulated in tamoxifen resistant breast cancer cells due to promoter methylation and regulates tamoxifen sensitivity by targeting HMGB3.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
References
Ref 1 Differential miRNA expression profiles in hepatocellular carcinoma cells and drug-resistant sublines. Oncol Rep. 2013 Feb;29(2):555-62. doi: 10.3892/or.2012.2155. Epub 2012 Nov 28.
Ref 2 Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b. Med Sci Monit. 2016 Oct 1;22:3506-3513. doi: 10.12659/msm.900688.
Ref 3 miR-27 is associated with chemoresistance in esophageal cancer through transformation of normal fibroblasts to cancer-associated fibroblasts. Carcinogenesis. 2015 Aug;36(8):894-903. doi: 10.1093/carcin/bgv067. Epub 2015 May 30.
Ref 4 Effect of microRNA-27b on cisplatin chemotherapy sensitivity of oral squamous cell carcinoma via FZD7 signaling pathway. Oncol Lett. 2019 Jul;18(1):667-673. doi: 10.3892/ol.2019.10347. Epub 2019 May 13.
Ref 5 miR-27b synergizes with anticancer drugs via p53 activation and CYP1B1 suppression. Cell Res. 2015 Apr;25(4):477-95. doi: 10.1038/cr.2015.23. Epub 2015 Feb 20.
Ref 6 MicroRNAs regulate CYP3A4 expression via direct and indirect targeting. Drug Metab Dispos. 2009 Oct;37(10):2112-7. doi: 10.1124/dmd.109.027680. Epub 2009 Jul 6.
Ref 7 MicroRNA-27b reverses docetaxel resistance of non-small cell lung carcinoma cells via targeting epithelial growth factor receptor. Mol Med Rep. 2016 Jul;14(1):949-54. doi: 10.3892/mmr.2016.5332. Epub 2016 May 24.
Ref 8 miR-27b and miR-34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1. Biomed Pharmacother. 2018 Jan;97:736-744. doi: 10.1016/j.biopha.2017.10.163. Epub 2017 Nov 6.
Ref 9 MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
Ref 10 Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
Ref 11 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 12 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 13 MiR-27b is epigenetically downregulated in tamoxifen resistant breast cancer cells due to promoter methylation and regulates tamoxifen sensitivity by targeting HMGB3. Biochem Biophys Res Commun. 2016 Sep 2;477(4):768-773. doi: 10.1016/j.bbrc.2016.06.133. Epub 2016 Jun 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.