Molecule Information
General Information of the Molecule (ID: Mol01412)
Name |
hsa-mir-27b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 27b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR27B
|
||||
Gene ID | |||||
Location |
chr9:95085445-95085541[+]
|
||||
Sequence |
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUG
UUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
13 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Carboplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
SGC-7901/FU cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis assay | |||
Mechanism Description | LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b. | |||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
|
||||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | TE10 cells | Esophagus | Homo sapiens (Human) | CVCL_1760 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-27 in serum originated mainly from esophageal cancer cells, because its serum expression level in patients with esophageal cancer was significantly higher than that of healthy volunteers and decreased significantly after surgery compared with the baseline (before surgery). Moreover, co-culture of fibroblasts with anti-miR-27-transfected esophageal cancer cells resulted in a major decrease in the antiapoptotic function of fibroblasts, compared with fibroblasts co-cultured with control esophageal cancer cells that secrete extracellular miR-27. Serum miR-27 level may reflect the expression level of extracellular miR-27 derived from esophageal cancer cells. miR-27 is involved in resistance to chemotherapy in esophageal cancer, through miR-27 -induced transformation of NOF into CAF, and that TGF-beta secreted from these CAF-like fibroblasts induces chemoresistance to cisplatin in esophageal cancer. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Oral squamous cell carcinoma | [4] | |||
Sensitive Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
FZD7/beta-catenin signaling pathway | Activation | hsa05224 | ||
In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
Colony formation assay; Flow cytometry assay | |||
Mechanism Description | miR-27b can increase the sensitivity of OSCC cells to cisplatin drugs, significantly inhibit OSCC cell proliferation, promote cell apoptosis, and inhibit cell invasion and migration, which may be related to the inhibition of FDZ7/beta-catenin signaling pathway by miR-27b. | |||
Disease Class: Liver cancer | [5] | |||
Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon carcinoma | [6] | |||
Resistant Disease | Colon carcinoma [ICD-11: 2B90.2] | |||
Resistant Drug | Cyclophosphamide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | LS-180 cells | Colon | Homo sapiens (Human) | CVCL_0397 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Sulforhodamine B assay | |||
Mechanism Description | CYP3A4 is the most abundant hepatic and intestinal cytochrome P450 enzyme in humans, contributing to the metabolism of various drugs such as benzodiazepines, HIV antivirals, macrolide antibiotics, and statins. CYP3A4 3'UTR-luciferase activity was significantly decreased in human embryonic kidney 293 cells transfected with plasmid that expressed microRNA-27b (miR-27b) or mouse microRNA-298 (mmu-miR-298), overexpression of miR-27b or mmu-miR-298 in PANC1 cells led to a lower sensitivity to cyclophosphamide. | |||
Disease Class: Pancreatic cancer | [6] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Cyclophosphamide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Panc1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Sulforhodamine B assay | |||
Mechanism Description | CYP3A4 is the most abundant hepatic and intestinal cytochrome P450 enzyme in humans, contributing to the metabolism of various drugs such as benzodiazepines, HIV antivirals, macrolide antibiotics, and statins. CYP3A4 3'UTR-luciferase activity was significantly decreased in human embryonic kidney 293 cells transfected with plasmid that expressed microRNA-27b (miR-27b) or mouse microRNA-298 (mmu-miR-298), overexpression of miR-27b or mmu-miR-298 in PANC1 cells led to a lower sensitivity to cyclophosphamide. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [7] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
EGFR signaling pathway | Inhibition | hsa01521 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The transfection of miR 27b mimics led to downregulation of the expression levels of EGFR, whilst miR 27b inhibitors upregulated the expression levels of EGFR. Furthermore, it was demonstrated that the transfection of miR 27b mimics significantly suppressed the apoptosis and promote the viability of A549 human lung carcinoma cells. In line with this, the introduction of miR 27b inhibitors significantly induced apoptosis and inhibited the proliferation of A549 cells. These results indicate that miR 27b may promote NSCLC cell viability and enhance resistance to docetaxel treatment through direct inhibition of EGFR expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [8] | |||
Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
PrEC cells | Prostate | Homo sapiens (Human) | CVCL_0061 | |
HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR27b and miR34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
SGC-7901/FU cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis assay | |||
Mechanism Description | LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b. | |||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [5] | |||
Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [5] | |||
Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
Sensitive Drug | Epirubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Epirubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [5] | |||
Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
SGC-7901/FU cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V-FITC Apoptosis assay | |||
Mechanism Description | LncRNA urothelial carcinoma associated 1 (UCA1) increases multi-drug resistance of gastric cancer via downregulating miR27b. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [5] | |||
Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Mitomycin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [5] | |||
Sensitive Disease | Liver cancer [ICD-11: 2C12.6] | |||
Sensitive Drug | Sorafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
SNU-739 cells | Liver | Homo sapiens (Human) | CVCL_5088 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. | |||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Sorafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR27b/CCNG1/p53 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | 769-P cells | Kidney | Homo sapiens (Human) | CVCL_1050 |
786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
Mechanism Description | miR-27b synergizes with anticancer drugs througth enhancing anticancer drug-induced cell death which due to p53 activation and CYP1B1 suppression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [9] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Tamoxifen | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Transwell assay; Promega assay | |||
Mechanism Description | miR-27b is epigenetically downregulated in tamoxifen resistant breast cancer cells due to promoter methylation and regulates tamoxifen sensitivity by targeting HMGB3. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.