Molecule Information
General Information of the Molecule (ID: Mol01451)
| Name |
hsa-mir-200c
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 200c
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR200C
|
||||
| Gene ID | |||||
| Location |
chr12:6963699-6963766[+]
|
||||
| Sequence |
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAU
GAUGGAGG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
23 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Carboplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 |
| MES-OV cells | Ovary | Homo sapiens (Human) | CVCL_CZ92 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
SRB colorimetric assay; Flow cytometry assay | |||
| Mechanism Description | The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [3] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Sk-MES-1 cells | Lung | Homo sapiens (Human) | CVCL_0630 | |
| NCI-H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| NCI-H522 cells | Lung | Homo sapiens (Human) | CVCL_1567 | |
| NCl-H596 cells | Lung | Homo sapiens (Human) | CVCL_1571 | |
| NCI-H520 cells | Lung | Homo sapiens (Human) | CVCL_1566 | |
| Calu1 cells | Lung | Homo sapiens (Human) | CVCL_0608 | |
| NCI-H1395 cells | Lung | Homo sapiens (Human) | CVCL_1467 | |
| Experiment for Molecule Alteration |
Methylation-specific PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Reintroduction of miR-200c into highly invasive/aggressive NSCLC cells induced a loss of the mesenchymal phenotype by restoring E-cadherin and reducing N-cadherin expression, and inhibited in vitro cell invasion as well as in vivo metastasis formation. | |||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [4] | |||
| Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Sensitive Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | EGFR signaling pathway | Regulation | N.A. | |
| In Vitro Model | 253J BV cells | Bladder | Homo sapiens (Human) | CVCL_7937 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Pulse-labeling cells with [3H]thymidine | |||
| Mechanism Description | Members of the miR-200 family appear to control the EMT process and sensitivity to EGFR therapy, in bladder cancer cells and that expression of miR-200 is sufficient to restore EGFR dependency, at least in some of the mesenchymal bladder cancer cells. The targets of miR-200 include ERRFI-1, which is a novel regulator of EGFR-independent growth. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [5] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | NER signaling pathway | Activation | hsa03420 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-200c reverses drug resistance of human gastric cancer cells by targeting regulation of the NER-ERCC3/4 pathway. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [6] | |||
| Resistant Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Clonogenic assay | |||
| Mechanism Description | The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins. | |||
| Disease Class: Endometrial cancer [ICD-11: 2C76.1] | [6] | |||
| Resistant Disease | Endometrial cancer [ICD-11: 2C76.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEC-1A cells | Uterus | Homo sapiens (Human) | CVCL_0293 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Clonogenic assay | |||
| Mechanism Description | The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins. | |||
| Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] | [7] | |||
| Resistant Disease | Esophageal adenocarcinoma [ICD-11: 2B70.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Beta-catenin signaling pathway | Activation | hsa04520 | |
| Cell apoptosis | Inhibition | hsa04210 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | Ishikawa cells | Endometrium | Homo sapiens (Human) | CVCL_2529 |
| HEC-1A cells | Uterus | Homo sapiens (Human) | CVCL_0293 | |
| 2774 cells | Ovary | Homo sapiens (Human) | CVCL_0420 | |
| AN3CA cells | Ovary | Homo sapiens (Human) | CVCL_0028 | |
| KLE cells | Ovary | Homo sapiens (Human) | CVCL_1329 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | BRD7 is known to mediate tumor suppression by down-regulation of the beta-catenin pathway through accumulation of beta-catenin in the cytoplasm. miR-200c regulated the translocation of beta-catenin from the cytoplasm to the nucleus via inhibition of BRD7, resulting in increased expression of its transcriptional target genes, cyclinD1 and c-myc, miR-200c induces additive effect on the cisplatin cytotoxicity of endometrial carcinoma cells. | |||
| Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] | [8] | |||
| Resistant Disease | Gastric adenocarcinoma [ICD-11: 2B72.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Fas/FasL signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [8] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Fas/FasL signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| A549/CDDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP. | |||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [9] | |||
| Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | AKT signaling pathway | Activation | hsa04151 | |
| Cell apoptosis | Inhibition | hsa04210 | ||
| In Vitro Model | TE13 cells | Esophageal | Homo sapiens (Human) | CVCL_4463 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-200c as the miRNA responsible for chemoresistance in esophageal cancer. knockdown of miR-200c expression was associated with increased expression of PPP2R1B, a subunit of protein phosphatase 2A (PP2A), which is known to inhibit the phosphorylation of Akt, miR-200c-induced resistance is mediated through the Akt pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [10] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HOS cells | Bone | Homo sapiens (Human) | CVCL_0312 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR; RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis; Caspase-3 Activity Assay | |||
| Mechanism Description | miR200c regulates tumor growth and chemosensitivity to cisplatin in osteosarcoma by targeting AkT2 and inhibiting the activity of cell proliferation and cell migration. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [11] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | BIRC6/p53-mediated apoptosis signaling pathway | Activation | hsa04210 | |
| ZEB2 signaling pathway | Inhibition | hsa05202 | ||
| In Vitro Model | SGC7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-200c regulates cisplatin resistance by targeting ZEB2 in human gastric cancer cells. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [12] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| A2780CP cells | Ovary | Homo sapiens (Human) | CVCL_0135 | |
| HIOSE-80 cells | Ovary | Homo sapiens (Human) | CVCL_E274 | |
| OV119 cells | Ovary | Homo sapiens (Human) | N.A. | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-200b- and miR-200c-mediated downregulation of DNMTs may improve chemotherapeutic efficacy by increasing the sensitivity of cancer cells. | |||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [13] | |||
| Sensitive Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Endoscopy; Computed tomography assay; Positron emission tomography assay | |||
| Mechanism Description | Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [14] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The knockdown of RhoE enhanced the sensitivity of SGC7901/DDP cells and changed expres-sion of some genes. Transfection of pre-miR-200c reduces RhoEexpression. miRNA-200cregulated the sensitivity of chemotherapy to cisplatin(DDP) in gastric cancer by possibly targeting RhoE. | |||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [3] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Sk-MES-1 cells | Lung | Homo sapiens (Human) | CVCL_0630 | |
| NCI-H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| NCI-H522 cells | Lung | Homo sapiens (Human) | CVCL_1567 | |
| NCl-H596 cells | Lung | Homo sapiens (Human) | CVCL_1571 | |
| NCI-H520 cells | Lung | Homo sapiens (Human) | CVCL_1566 | |
| Calu1 cells | Lung | Homo sapiens (Human) | CVCL_0608 | |
| NCI-H1395 cells | Lung | Homo sapiens (Human) | CVCL_1467 | |
| Experiment for Molecule Alteration |
Methylation-specific PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Reintroduction of miR-200c into highly invasive/aggressive NSCLC cells induced a loss of the mesenchymal phenotype by restoring E-cadherin and reducing N-cadherin expression, and inhibited in vitro cell invasion as well as in vivo metastasis formation. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [15] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Crizotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| NCI-2228 cells | Lung | Homo sapiens (Human) | CVCL_1543 | |
| NCI-2228/CRI cells | Lung | Homo sapiens (Human) | CVCL_1543 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR200c regulates crizotinib-resistant ALk-positive lung cancer cells by reversing epithelial-mesenchymal transition via targeting ZEB1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [17] | |||
| Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
| PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Docetaxel-resistant cells showed a reduced E-cadherin and an increased vimentin expression accompanied by induced expression of stem cell markers compared with parental cells. Decreased Expression of miR-200c and miR-205 Is Responsible for E-Cadherin Loss in Chemotherapy-Resistant Cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [13] | |||
| Sensitive Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Endoscopy; Computed tomography assay; Positron emission tomography assay | |||
| Mechanism Description | Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [18] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). | |||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [19], [20], [21] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | DNA damage repair signaling pathway | Activation | hsa03410 | |
| PTEN/AKT signaling pathway | Activation | hsa05235 | ||
| miR151a-3p/XRCC4 signaling pathway | Regulation | N.A. | ||
| p53 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
| MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Celltiter glo assay | |||
| Mechanism Description | The loss of miRNA-200c correlates with the acquired resistance of breast cancer cells to ADR, the loss of miRNA-200c correlated with decreased levels of E-cadherin and PTEN, and increased levels of ZEB1 and phospho-Akt (p-Akt) in ADR-resistant breast cancer cells (MCF-7/ADR cells). miRNA-200c inhibited Akt signaling through its effects on E-cadherin and PTEN, resulting in the inhibition of ADR resistance in breast cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [13] | |||
| Sensitive Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Endoscopy; Computed tomography assay; Positron emission tomography assay | |||
| Mechanism Description | Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery. | |||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [22] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
| HCC70 cells | Breast | Homo sapiens (Human) | CVCL_1270 | |
| Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
| MDA-MB-361 cells | Breast | Homo sapiens (Human) | CVCL_0620 | |
| CAMA-1 cells | Breast | Homo sapiens (Human) | CVCL_1115 | |
| MCF-10-2A cells | Breast | Homo sapiens (Human) | CVCL_3743 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Celltiter-blue cell viability assay | |||
| Mechanism Description | The up-regulation of the miR-200b and miR-200c diminishes EMT by directly targeting the transcriptional repressor ZEB1 leading to up-regulation of E-cadherin. Restoration of E-cadherin expression increases the sensitivity of cancer cells to chemotherapeutic agents. Disruption of ZEB1-histone deacetylase repressor complexes and down-regulation of histone deacetylase, in particular SIRT1, positively affect the p53 apoptotic pathway leading to the increased sensitivity of breast cancer cells to chemotherapy and radiotherapy. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Endometrial cancer [ICD-11: 2C76.1] | [23] | |||
| Sensitive Disease | Endometrial cancer [ICD-11: 2C76.1] | |||
| Sensitive Drug | Epothilone B | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| In Vitro Model | Hec50 cells | Endometrium | Homo sapiens (Human) | CVCL_2929 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
ELISA assay | |||
| Mechanism Description | Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [24] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Erlotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| TGF-Beta/miR200/MIG6 signaling pathway | Inhibition | hsa05206 | ||
| In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
| H292 cells | Lung | Homo sapiens (Human) | CVCL_0455 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| NCl-H226 cells | Lung | Homo sapiens (Human) | CVCL_1544 | |
| NCl-H1437 cells | Lung | Homo sapiens (Human) | CVCL_1472 | |
| H1703 cells | Lung | Homo sapiens (Human) | CVCL_1490 | |
| H23 cells | Lung | Homo sapiens (Human) | CVCL_1547 | |
| Calu6 cells | Lung | Homo sapiens (Human) | CVCL_0236 | |
| H1838 cells | Lung | Homo sapiens (Human) | CVCL_1499 | |
| H1915 cells | Lung | Homo sapiens (Human) | CVCL_1505 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR; RT-PCR | |||
| Experiment for Drug Resistance |
Alamar Blue assay | |||
| Mechanism Description | The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo. | |||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [24] | |||
| Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Sensitive Drug | Erlotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| TGF-Beta/miR200/MIG6 signaling pathway | Inhibition | hsa05206 | ||
| In Vitro Model | Calu3 cells | Lung | Homo sapiens (Human) | CVCL_0609 |
| H292 cells | Lung | Homo sapiens (Human) | CVCL_0455 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| NCl-H226 cells | Lung | Homo sapiens (Human) | CVCL_1544 | |
| NCl-H1437 cells | Lung | Homo sapiens (Human) | CVCL_1472 | |
| H1703 cells | Lung | Homo sapiens (Human) | CVCL_1490 | |
| H23 cells | Lung | Homo sapiens (Human) | CVCL_1547 | |
| Calu6 cells | Lung | Homo sapiens (Human) | CVCL_0236 | |
| H1838 cells | Lung | Homo sapiens (Human) | CVCL_1499 | |
| H1915 cells | Lung | Homo sapiens (Human) | CVCL_1505 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR; RT-PCR | |||
| Experiment for Drug Resistance |
Alamar Blue assay | |||
| Mechanism Description | The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [25] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT signaling pathway | Inhibition | hsa04151 | |
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V/ PI staining; Caspase-3 activity assay | |||
| Mechanism Description | Levels of PTEN and E-cadherin were reduced by knockdown of miR200c in HCT-116 cells, PTEN inactivate the AkT signaling pathway, and E-cadherin is one of the major downstream regulators of miRNA-200c contributing to EMT, which is also important to inhibit tumor invasion and proliferation as well as to induce cell apoptosis. | |||
| Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] | [26] | |||
| Sensitive Disease | Cholangiocarcinoma [ICD-11: 2C12.0] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| In Vitro Model | QBC939 cells | Bile duct | Homo sapiens (Human) | CVCL_6942 |
| TFk-1 cells | Bile duct | Homo sapiens (Human) | CVCL_2214 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
WST cell counting kit-8 | |||
| Mechanism Description | miR-200b/c influenced the tumourigenesis of cholangiocarcinoma cells including their tumour-initiating capacity, sphere formation, and drug resistance (like fluorouracil). We further found that miR-200b/c regulated migration and invasion capacities by directly targeting rho-kinase 2 and regulated tumorigenic properties by directly targeting SUZ12 (a subunit of a polycomb repressor complex). | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [27] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MDA-MB-453 cells | Breast | Homo sapiens (Human) | CVCL_0418 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-200c and miR-203 overexpression in breast cancer cells downregulated Bmi1 expression accompanied with reversion of resistance to 5-Fu mediated by Bmi1. | |||
| Disease Class: Esophageal cancer [ICD-11: 2B70.1] | [13] | |||
| Sensitive Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Endoscopy; Computed tomography assay; Positron emission tomography assay | |||
| Mechanism Description | Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [28] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Fulvestrant | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
RT-qPCR; Western blot | |||
| Experiment for Drug Resistance |
MTT Assay; BrdU Assay; Wound Healing Assay | |||
| Mechanism Description | Our data indicate that reduced miRNA-200b and miR-200c expression contributes to endocrine resistance in breast cancer cells and that the reduced expression of these miR-200 family members in endocrine-resistant cells can be reversed by 5-aza-dC+TSA. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [29] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 |
| PC9-ZD cells | Lung | Homo sapiens (Human) | CVCL_V337 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin-V/PI assay; Wound healing assay | |||
| Mechanism Description | miR200c enhances sensitivity of drug-resistant non-small cell lung cancer to gefitinib by suppression of PI3k/Akt signaling pathway and inhibites cell migration via targeting ZEB1. | |||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [30] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| MEK/ERK signaling pathway | Regulation | N.A. | ||
| PI3K/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
| H23 cells | Lung | Homo sapiens (Human) | CVCL_1547 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Ectopic expression of miR-200c resulted in partial restoration of gefitinib sensitivity in NSCLC cells with ZEB1 downrerulating. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [31] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | Re-expression of miR-200 in gemcitabine-resistant cells showed partial reversal of EMT characteristics as documented by increased expression of E-cadherin and decreased expression of vimentin, ZEB1, and slug. These results suggest that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin and that the re-expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-epithelial transition (MET). re-expression of miR-200 by transfection studies or treatment of gemcitabine-resistant cells with either DIM or isoflavone resulted in the down-regulation of ZEB1, slug, and vimentin, which was consistent with morphological reversal of EMT phenotype leading to epithelial morphology. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] | [32] | |||
| Sensitive Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
| Sensitive Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 |
| SN12C cells | Kidney | Homo sapiens (Human) | CVCL_1705 | |
| ACHN cells | Pleural effusion | Homo sapiens (Human) | CVCL_1067 | |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| Caki-1 cells | Kidney | Homo sapiens (Human) | CVCL_0234 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | In the present study, we demonstrated the regulatory relationship between miR-200c and HO-1. We provided evidences to elucidate that miR-200c could sensitize ccRCC cells to sorafenib or imatinib to inhibit cell proliferation, at least partly by targeting HO-1. Moreover, the correlation between miR-200c and HO-1 expression level and drug resistance in ccRCC was also determined. Combined application with chemotherapeutic drugs, miR-200c, a HO-1 inhibitor, may enhance the efficiency of therapy by promoting both apoptosis and autophagy. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [33] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Intedanib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 | |
| PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
| NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
| PC-14 cells | Lung | Homo sapiens (Human) | CVCL_1640 | |
| EBC-1 cells | Lung | Homo sapiens (Human) | CVCL_2891 | |
| LC-1/sq cells | Lung | Homo sapiens (Human) | CVCL_3008 | |
| LC-2/ad cells | Lung | Homo sapiens (Human) | CVCL_1373 | |
| Lk-2 cells | Lung | Homo sapiens (Human) | CVCL_1377 | |
| NCI-HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
| PC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_S978 | |
| PC-10 cells | Lung | Homo sapiens (Human) | CVCL_7088 | |
| QG56 cells | Lung | Homo sapiens (Human) | CVCL_6943 | |
| RERF-LCkJ cells | Lung | Homo sapiens (Human) | CVCL_1654 | |
| SQ5 cells | Lung | Homo sapiens (Human) | CVCL_8273 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-200b and miR-141 associated with epithelial-mesenchymal transition (EMT) are predictive biomarkers and therapeutic targets of nintedanib in NSCLC cells. nintedanib inhibited EMT and reversed the resistance to EGFR-TkI with TGF-beta-induced EMT through miR-200 family induction in NSCLC cells. low expression of miR-200b and miR-141, resulting in high level of ZEB1 and low level of E-cadherin, was associated with the resistance to nintedanib in NSCLC cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [34] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| LUCAT1/miR200c/ABCB1 pathway | Regulation | N.A. | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HOS cells | Bone | Homo sapiens (Human) | CVCL_0312 | |
| HFOB cells | Bone | Homo sapiens (Human) | CVCL_3708 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Transwell invasion assay | |||
| Mechanism Description | Long non-coding RNA LUCAT1 modulates methotrexate resistance in osteosarcoma via miR200c/ABCB1 axis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [35] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Methotrexate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| P53/P21/EZH2/E-cad signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Transwell assay | |||
| Mechanism Description | Over expression of miR-200c reduced the resistance of A549/MTX cells to MTX with the mechanism of inducing apoptosis through the P53/P21 pathway. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [36] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Gastric cancer patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | qRT-PCR analysis was used to validate the results from the RNA sequencing. The expression levels of the DE miRNAs were analyzed following the chemotherapy cycles. The expression levels of miR-378f, miR-200c-3p, and miR-885-5p were higher in the group receiving chemotherapy for fewer than 4 cycles than in the group receiving chemotherapy for 4-7 cycles. The expression of miR-4666a-3p was not detectable in the qRT-PCR measurement. The expression of miR-378f was significantly downregulated (p = 0.0041) (Figure 2). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 |
| MES-OV cells | Ovary | Homo sapiens (Human) | CVCL_CZ92 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
SRB colorimetric assay; Flow cytometry assay | |||
| Mechanism Description | The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [37] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | A miRNA-200c/cathepsin L feedback loop determines paclitaxel resistance in human lung cancer A549 cells in vitro through regulating epithelial-mesenchymal transition. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [38] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell adhesion | Inhibition | hsa04514 | |
| Cell apoptosis | Inhibition | hsa04210 | ||
| Cell migration | Activation | hsa04670 | ||
| In Vitro Model | HEY cells | Ovary | Homo sapiens (Human) | CVCL_0297 |
| SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
| OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
| OV 1847 cells | Breast | Homo sapiens (Human) | CVCL_D703 | |
| OVCA 420 cells | Breast | Homo sapiens (Human) | CVCL_3935 | |
| In Vivo Model | (NOD) /SCID nude mouse xenograft model | . | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of TUBB3 is thought to result in resistance to taxanes is by enhancement of the dynamic instability of microtubules, thereby counteracting the activity of microtubule targeting agents. Transient restoration of miR-200c using miRNA mimics cause a significant decrease in TUBB3 levels, thus results in the resistance to taxanes. | |||
|
|
||||
| Disease Class: Endometrial cancer [ICD-11: 2C76.1] | [23] | |||
| Sensitive Disease | Endometrial cancer [ICD-11: 2C76.1] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| In Vitro Model | Hec50 cells | Endometrium | Homo sapiens (Human) | CVCL_2929 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
ELISA assay | |||
| Mechanism Description | Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] | [32] | |||
| Sensitive Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 |
| SN12C cells | Kidney | Homo sapiens (Human) | CVCL_1705 | |
| ACHN cells | Pleural effusion | Homo sapiens (Human) | CVCL_1067 | |
| 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 | |
| Caki-1 cells | Kidney | Homo sapiens (Human) | CVCL_0234 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | In the present study, we demonstrated the regulatory relationship between miR-200c and HO-1. We provided evidences to elucidate that miR-200c could sensitize ccRCC cells to sorafenib or imatinib to inhibit cell proliferation, at least partly by targeting HO-1. Moreover, the correlation between miR-200c and HO-1 expression level and drug resistance in ccRCC was also determined. Combined application with chemotherapeutic drugs, miR-200c, a HO-1 inhibitor, may enhance the efficiency of therapy by promoting both apoptosis and autophagy. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [39] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [40] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
| Cell metastasis | Inhibition | hsa05205 | ||
| In Vitro Model | U87MG cells | Brain | Homo sapiens (Human) | CVCL_GP63 |
| DBTRG-05MG cells | Brain | Homo sapiens (Human) | CVCL_1169 | |
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-200c overexpression in DBTRG cells was able to downregulate both PDHA1 and TIGAR, which are involved in OXPHOS and glycolysis regulation. PDHA1 was described as the major provider of carbon for the TCA in GB. miR-200c overexpression was able to decrease DBTRG cell mobility. The observed effect of miR-200c on the mobility of DBTRG cells could be attributed to miR-200c modulation of E-cadherin levels, and consequent repression of epithelial-mesenchymal transition (EMT). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: HER2 positive breast cancer [ICD-11: 2C60.8] | [41] | |||
| Resistant Disease | HER2 positive breast cancer [ICD-11: 2C60.8] | |||
| Resistant Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| TGF-beta signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Lnc-ATB is up-regulated in TR breast cancer tissues and TR SkBR-3 cells. Up-regulation of lnc-ATB account for the trastuzumab resistance and high invasiveness of TR SkBR-3 cells. miR-200c is down-regulated and inverse correlated with lnc-ATB in TR breast cancer tissues and TR SkBR-3 cells. Lnc-ATB functions as a ceRNA by competitively biding miR-200c in TR SkBR-3 cells. Lnc-ATB up-regulates and positive correlates with ZEB1 and ZNF217 levels. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [42] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| TGF-Beta/ZEB1 signaling pathway | Inhibition | hsa04350 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-200c, which was the most significantly downregulated miRNA in trastuzumab-resistant cells, restored trastuzumab sensitivity and suppressed invasion of breast cancer cells by concurrently targeting ZNF217, a transcriptional activator of TGF-beta, and ZEB1, a known mediator of TGF-beta signaling. Restoration of miR-200c, silencing of ZEB1 or ZNF217 or blockade of TGF-beta signaling increased trastuzumab sensitivity and suppressed invasiveness of breast cancer cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [43] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] | [8] | |||
| Resistant Disease | Gastric adenocarcinoma [ICD-11: 2B72.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Fas/FasL signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [8] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Fas/FasL signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| A549/CDDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Endometrial cancer [ICD-11: 2C76.1] | [23] | |||
| Sensitive Disease | Endometrial cancer [ICD-11: 2C76.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| In Vitro Model | Hec50 cells | Endometrium | Homo sapiens (Human) | CVCL_2929 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
ELISA assay | |||
| Mechanism Description | Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3. | |||
Clinical Trial Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [44] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Hydroxycamptothecin | |||
| Molecule Alteration | Expression | . |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| SGC-7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| Experiment for Molecule Alteration |
MiRNA microarray profiling, qRT-PCR | |||
| Experiment for Drug Resistance |
A sulforhodamine B (SRB) assay | |||
| Mechanism Description | MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [45] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | PD-0325901 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MEK-EGFR-PI3K signalling pathway | Regulation | N.A. | |
| In Vitro Model | Panc1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| CFPAC1 cells | Pancreas | Homo sapiens (Human) | CVCL_1119 | |
| HPAF-II cells | Pancreatic | Homo sapiens (Human) | CVCL_0313 | |
| Capan-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0026 | |
| BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 | |
| In Vivo Model | Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude) | Mus musculus | ||
| Experiment for Molecule Alteration |
Western blot | |||
| Experiment for Drug Resistance |
Cell growth inhibition assays; Apoptosis analysis | |||
| Mechanism Description | Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [1] | |||
| Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
| Resistant Drug | PLX4720 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | WM35 cells | Skin | Homo sapiens (Human) | CVCL_0580 |
| WM793 cells | N.A. | Homo sapiens (Human) | CVCL_8787/CVCL_5414 | |
| WM35 cells | Skin | Homo sapiens (Human) | CVCL_0580 | |
| 1205Lu cells | Skin | Homo sapiens (Human) | CVCL_5239 | |
| In Vivo Model | NU/NU athymic nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Western blot | |||
| Experiment for Drug Resistance |
Cell Proliferation Assay; Cell Cycle Analysis; Colony Formation Assay | |||
| Mechanism Description | Herein, we demonstrate that miR-200c is down-regulated in melanomas (primary and metastatic) compared with melanocytic nevi | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [1] | |||
| Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
| Resistant Drug | U0126 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | WM35 cells | Skin | Homo sapiens (Human) | CVCL_0580 |
| WM793 cells | N.A. | Homo sapiens (Human) | CVCL_8787/CVCL_5414 | |
| WM35 cells | Skin | Homo sapiens (Human) | CVCL_0580 | |
| 1205Lu cells | Skin | Homo sapiens (Human) | CVCL_5239 | |
| In Vivo Model | NU/NU athymic nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Western blot | |||
| Experiment for Drug Resistance |
Cell Proliferation Assay; Cell Cycle Analysis; Colony Formation Assay | |||
| Mechanism Description | Herein, we demonstrate that miR-200c is down-regulated in melanomas (primary and metastatic) compared with melanocytic nevi | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
