General Information of the Molecule (ID: Mol01451)
Name
hsa-mir-200c ,Homo sapiens
Synonyms
microRNA 200c
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR200C
Gene ID
406985
Location
chr12:6963699-6963766[+]
Sequence
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAU
GAUGGAGG
    Click to Show/Hide
Ensembl ID
ENSG00000207713
HGNC ID
HGNC:31580
Precursor Accession
MI0000650
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
23 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Carboplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
MES-OV cells Ovary Homo sapiens (Human) CVCL_CZ92
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
SRB colorimetric assay; Flow cytometry assay
Mechanism Description The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells.
Cetuximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Sk-MES-1 cells Lung Homo sapiens (Human) CVCL_0630
NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-H522 cells Lung Homo sapiens (Human) CVCL_1567
NCl-H596 cells Lung Homo sapiens (Human) CVCL_1571
NCI-H520 cells Lung Homo sapiens (Human) CVCL_1566
Calu1 cells Lung Homo sapiens (Human) CVCL_0608
NCI-H1395 cells Lung Homo sapiens (Human) CVCL_1467
Experiment for
Molecule Alteration
Methylation-specific PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Reintroduction of miR-200c into highly invasive/aggressive NSCLC cells induced a loss of the mesenchymal phenotype by restoring E-cadherin and reducing N-cadherin expression, and inhibited in vitro cell invasion as well as in vivo metastasis formation.
Disease Class: Bladder cancer [ICD-11: 2C94.0] [4]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation EGFR signaling pathway Regulation N.A.
In Vitro Model 253J BV cells Bladder Homo sapiens (Human) CVCL_7937
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Pulse-labeling cells with [3H]thymidine
Mechanism Description Members of the miR-200 family appear to control the EMT process and sensitivity to EGFR therapy, in bladder cancer cells and that expression of miR-200 is sufficient to restore EGFR dependency, at least in some of the mesenchymal bladder cancer cells. The targets of miR-200 include ERRFI-1, which is a novel regulator of EGFR-independent growth.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation NER signaling pathway Activation hsa03420
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-200c reverses drug resistance of human gastric cancer cells by targeting regulation of the NER-ERCC3/4 pathway.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [6]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.
Disease Class: Endometrial cancer [ICD-11: 2C76.1] [6]
Resistant Disease Endometrial cancer [ICD-11: 2C76.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEC-1A cells Uterus Homo sapiens (Human) CVCL_0293
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [7]
Resistant Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Beta-catenin signaling pathway Activation hsa04520
Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model Ishikawa cells Endometrium Homo sapiens (Human) CVCL_2529
HEC-1A cells Uterus Homo sapiens (Human) CVCL_0293
2774 cells Ovary Homo sapiens (Human) CVCL_0420
AN3CA cells Ovary Homo sapiens (Human) CVCL_0028
KLE cells Ovary Homo sapiens (Human) CVCL_1329
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description BRD7 is known to mediate tumor suppression by down-regulation of the beta-catenin pathway through accumulation of beta-catenin in the cytoplasm. miR-200c regulated the translocation of beta-catenin from the cytoplasm to the nucleus via inhibition of BRD7, resulting in increased expression of its transcriptional target genes, cyclinD1 and c-myc, miR-200c induces additive effect on the cisplatin cytotoxicity of endometrial carcinoma cells.
Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [8]
Resistant Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Disease Class: Lung cancer [ICD-11: 2C25.5] [8]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [9]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
Cell apoptosis Inhibition hsa04210
In Vitro Model TE13 cells Esophageal Homo sapiens (Human) CVCL_4463
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-200c as the miRNA responsible for chemoresistance in esophageal cancer. knockdown of miR-200c expression was associated with increased expression of PPP2R1B, a subunit of protein phosphatase 2A (PP2A), which is known to inhibit the phosphorylation of Akt, miR-200c-induced resistance is mediated through the Akt pathway.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [10]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HOS cells Bone Homo sapiens (Human) CVCL_0312
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis; Caspase-3 Activity Assay
Mechanism Description miR200c regulates tumor growth and chemosensitivity to cisplatin in osteosarcoma by targeting AkT2 and inhibiting the activity of cell proliferation and cell migration.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [11]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation BIRC6/p53-mediated apoptosis signaling pathway Activation hsa04210
ZEB2 signaling pathway Inhibition hsa05202
In Vitro Model SGC7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-200c regulates cisplatin resistance by targeting ZEB2 in human gastric cancer cells.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [12]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
HIOSE-80 cells Ovary Homo sapiens (Human) CVCL_E274
OV119 cells Ovary Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-200b- and miR-200c-mediated downregulation of DNMTs may improve chemotherapeutic efficacy by increasing the sensitivity of cancer cells.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [13]
Sensitive Disease Esophageal cancer [ICD-11: 2B70.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Endoscopy; Computed tomography assay; Positron emission tomography assay
Mechanism Description Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [14]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The knockdown of RhoE enhanced the sensitivity of SGC7901/DDP cells and changed expres-sion of some genes. Transfection of pre-miR-200c reduces RhoEexpression. miRNA-200cregulated the sensitivity of chemotherapy to cisplatin(DDP) in gastric cancer by possibly targeting RhoE.
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Sk-MES-1 cells Lung Homo sapiens (Human) CVCL_0630
NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-H522 cells Lung Homo sapiens (Human) CVCL_1567
NCl-H596 cells Lung Homo sapiens (Human) CVCL_1571
NCI-H520 cells Lung Homo sapiens (Human) CVCL_1566
Calu1 cells Lung Homo sapiens (Human) CVCL_0608
NCI-H1395 cells Lung Homo sapiens (Human) CVCL_1467
Experiment for
Molecule Alteration
Methylation-specific PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Reintroduction of miR-200c into highly invasive/aggressive NSCLC cells induced a loss of the mesenchymal phenotype by restoring E-cadherin and reducing N-cadherin expression, and inhibited in vitro cell invasion as well as in vivo metastasis formation.
Crizotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [15]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Crizotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-2228 cells Lung Homo sapiens (Human) CVCL_1543
NCI-2228/CRI cells Lung Homo sapiens (Human) CVCL_1543
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR200c regulates crizotinib-resistant ALk-positive lung cancer cells by reversing epithelial-mesenchymal transition via targeting ZEB1.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [17]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Docetaxel-resistant cells showed a reduced E-cadherin and an increased vimentin expression accompanied by induced expression of stem cell markers compared with parental cells. Decreased Expression of miR-200c and miR-205 Is Responsible for E-Cadherin Loss in Chemotherapy-Resistant Cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [13]
Sensitive Disease Esophageal cancer [ICD-11: 2B70.1]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Endoscopy; Computed tomography assay; Positron emission tomography assay
Mechanism Description Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [18]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [19], [20], [21]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation DNA damage repair signaling pathway Activation hsa03410
PTEN/AKT signaling pathway Activation hsa05235
miR151a-3p/XRCC4 signaling pathway Regulation N.A.
p53 signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
BT474 cells Breast Homo sapiens (Human) CVCL_0179
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Celltiter glo assay
Mechanism Description The loss of miRNA-200c correlates with the acquired resistance of breast cancer cells to ADR, the loss of miRNA-200c correlated with decreased levels of E-cadherin and PTEN, and increased levels of ZEB1 and phospho-Akt (p-Akt) in ADR-resistant breast cancer cells (MCF-7/ADR cells). miRNA-200c inhibited Akt signaling through its effects on E-cadherin and PTEN, resulting in the inhibition of ADR resistance in breast cancer cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [13]
Sensitive Disease Esophageal cancer [ICD-11: 2B70.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Endoscopy; Computed tomography assay; Positron emission tomography assay
Mechanism Description Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [22]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT549 cells Breast Homo sapiens (Human) CVCL_1092
HCC70 cells Breast Homo sapiens (Human) CVCL_1270
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
CAMA-1 cells Breast Homo sapiens (Human) CVCL_1115
MCF-10-2A cells Breast Homo sapiens (Human) CVCL_3743
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-blue cell viability assay
Mechanism Description The up-regulation of the miR-200b and miR-200c diminishes EMT by directly targeting the transcriptional repressor ZEB1 leading to up-regulation of E-cadherin. Restoration of E-cadherin expression increases the sensitivity of cancer cells to chemotherapeutic agents. Disruption of ZEB1-histone deacetylase repressor complexes and down-regulation of histone deacetylase, in particular SIRT1, positively affect the p53 apoptotic pathway leading to the increased sensitivity of breast cancer cells to chemotherapy and radiotherapy.
Epothilone B
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Endometrial cancer [ICD-11: 2C76.1] [23]
Sensitive Disease Endometrial cancer [ICD-11: 2C76.1]
Sensitive Drug Epothilone B
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
In Vitro Model Hec50 cells Endometrium Homo sapiens (Human) CVCL_2929
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
ELISA assay
Mechanism Description Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [24]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TGF-Beta/miR200/MIG6 signaling pathway Inhibition hsa05206
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
NCl-H1437 cells Lung Homo sapiens (Human) CVCL_1472
H1703 cells Lung Homo sapiens (Human) CVCL_1490
H23 cells Lung Homo sapiens (Human) CVCL_1547
Calu6 cells Lung Homo sapiens (Human) CVCL_0236
H1838 cells Lung Homo sapiens (Human) CVCL_1499
H1915 cells Lung Homo sapiens (Human) CVCL_1505
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR; RT-PCR
Experiment for
Drug Resistance
Alamar Blue assay
Mechanism Description The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.
Disease Class: Bladder cancer [ICD-11: 2C94.0] [24]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TGF-Beta/miR200/MIG6 signaling pathway Inhibition hsa05206
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
NCl-H1437 cells Lung Homo sapiens (Human) CVCL_1472
H1703 cells Lung Homo sapiens (Human) CVCL_1490
H23 cells Lung Homo sapiens (Human) CVCL_1547
Calu6 cells Lung Homo sapiens (Human) CVCL_0236
H1838 cells Lung Homo sapiens (Human) CVCL_1499
H1915 cells Lung Homo sapiens (Human) CVCL_1505
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR; RT-PCR
Experiment for
Drug Resistance
Alamar Blue assay
Mechanism Description The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [25]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Inhibition hsa04151
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V/ PI staining; Caspase-3 activity assay
Mechanism Description Levels of PTEN and E-cadherin were reduced by knockdown of miR200c in HCT-116 cells, PTEN inactivate the AkT signaling pathway, and E-cadherin is one of the major downstream regulators of miRNA-200c contributing to EMT, which is also important to inhibit tumor invasion and proliferation as well as to induce cell apoptosis.
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [26]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
In Vitro Model QBC939 cells Bile duct Homo sapiens (Human) CVCL_6942
TFk-1 cells Bile duct Homo sapiens (Human) CVCL_2214
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
WST cell counting kit-8
Mechanism Description miR-200b/c influenced the tumourigenesis of cholangiocarcinoma cells including their tumour-initiating capacity, sphere formation, and drug resistance (like fluorouracil). We further found that miR-200b/c regulated migration and invasion capacities by directly targeting rho-kinase 2 and regulated tumorigenic properties by directly targeting SUZ12 (a subunit of a polycomb repressor complex).
Disease Class: Breast cancer [ICD-11: 2C60.3] [27]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-200c and miR-203 overexpression in breast cancer cells downregulated Bmi1 expression accompanied with reversion of resistance to 5-Fu mediated by Bmi1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [13]
Sensitive Disease Esophageal cancer [ICD-11: 2B70.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Endoscopy; Computed tomography assay; Positron emission tomography assay
Mechanism Description Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.
Fulvestrant
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [28]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Fulvestrant
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-qPCR; Western blot
Experiment for
Drug Resistance
MTT Assay; BrdU Assay; Wound Healing Assay
Mechanism Description Our data indicate that reduced miRNA-200b and miR-200c expression contributes to endocrine resistance in breast cancer cells and that the reduced expression of these miR-200 family members in endocrine-resistant cells can be reversed by 5-aza-dC+TSA.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [29]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
PC9-ZD cells Lung Homo sapiens (Human) CVCL_V337
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin-V/PI assay; Wound healing assay
Mechanism Description miR200c enhances sensitivity of drug-resistant non-small cell lung cancer to gefitinib by suppression of PI3k/Akt signaling pathway and inhibites cell migration via targeting ZEB1.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [30]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
MEK/ERK signaling pathway Regulation N.A.
PI3K/AKT signaling pathway Regulation N.A.
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
PC9 cells Lung Homo sapiens (Human) CVCL_B260
H23 cells Lung Homo sapiens (Human) CVCL_1547
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Ectopic expression of miR-200c resulted in partial restoration of gefitinib sensitivity in NSCLC cells with ZEB1 downrerulating.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [31]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description Re-expression of miR-200 in gemcitabine-resistant cells showed partial reversal of EMT characteristics as documented by increased expression of E-cadherin and decreased expression of vimentin, ZEB1, and slug. These results suggest that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin and that the re-expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-epithelial transition (MET). re-expression of miR-200 by transfection studies or treatment of gemcitabine-resistant cells with either DIM or isoflavone resulted in the down-regulation of ZEB1, slug, and vimentin, which was consistent with morphological reversal of EMT phenotype leading to epithelial morphology.
Imatinib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [32]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
Sensitive Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
SN12C cells Kidney Homo sapiens (Human) CVCL_1705
ACHN cells Pleural effusion Homo sapiens (Human) CVCL_1067
786-O cells Kidney Homo sapiens (Human) CVCL_1051
Caki-1 cells Kidney Homo sapiens (Human) CVCL_0234
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description In the present study, we demonstrated the regulatory relationship between miR-200c and HO-1. We provided evidences to elucidate that miR-200c could sensitize ccRCC cells to sorafenib or imatinib to inhibit cell proliferation, at least partly by targeting HO-1. Moreover, the correlation between miR-200c and HO-1 expression level and drug resistance in ccRCC was also determined. Combined application with chemotherapeutic drugs, miR-200c, a HO-1 inhibitor, may enhance the efficiency of therapy by promoting both apoptosis and autophagy.
Intedanib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [33]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Intedanib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
PC9 cells Lung Homo sapiens (Human) CVCL_B260
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
PC-14 cells Lung Homo sapiens (Human) CVCL_1640
EBC-1 cells Lung Homo sapiens (Human) CVCL_2891
LC-1/sq cells Lung Homo sapiens (Human) CVCL_3008
LC-2/ad cells Lung Homo sapiens (Human) CVCL_1373
Lk-2 cells Lung Homo sapiens (Human) CVCL_1377
NCI-HCC827 cells Lung Homo sapiens (Human) CVCL_2063
PC-1 cells Pancreas Homo sapiens (Human) CVCL_S978
PC-10 cells Lung Homo sapiens (Human) CVCL_7088
QG56 cells Lung Homo sapiens (Human) CVCL_6943
RERF-LCkJ cells Lung Homo sapiens (Human) CVCL_1654
SQ5 cells Lung Homo sapiens (Human) CVCL_8273
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-200b and miR-141 associated with epithelial-mesenchymal transition (EMT) are predictive biomarkers and therapeutic targets of nintedanib in NSCLC cells. nintedanib inhibited EMT and reversed the resistance to EGFR-TkI with TGF-beta-induced EMT through miR-200 family induction in NSCLC cells. low expression of miR-200b and miR-141, resulting in high level of ZEB1 and low level of E-cadherin, was associated with the resistance to nintedanib in NSCLC cells.
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [34]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Methotrexate
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
LUCAT1/miR200c/ABCB1 pathway Regulation N.A.
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HOS cells Bone Homo sapiens (Human) CVCL_0312
HFOB cells Bone Homo sapiens (Human) CVCL_3708
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Transwell invasion assay
Mechanism Description Long non-coding RNA LUCAT1 modulates methotrexate resistance in osteosarcoma via miR200c/ABCB1 axis.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [35]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
P53/P21/EZH2/E-cad signaling pathway Activation hsa04115
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Transwell assay
Mechanism Description Over expression of miR-200c reduced the resistance of A549/MTX cells to MTX with the mechanism of inducing apoptosis through the P53/P21 pathway.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [36]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Gastric cancer patients Homo sapiens
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description qRT-PCR analysis was used to validate the results from the RNA sequencing. The expression levels of the DE miRNAs were analyzed following the chemotherapy cycles. The expression levels of miR-378f, miR-200c-3p, and miR-885-5p were higher in the group receiving chemotherapy for fewer than 4 cycles than in the group receiving chemotherapy for 4-7 cycles. The expression of miR-4666a-3p was not detectable in the qRT-PCR measurement. The expression of miR-378f was significantly downregulated (p = 0.0041) (Figure 2).
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
MES-OV cells Ovary Homo sapiens (Human) CVCL_CZ92
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
SRB colorimetric assay; Flow cytometry assay
Mechanism Description The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [37]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description A miRNA-200c/cathepsin L feedback loop determines paclitaxel resistance in human lung cancer A549 cells in vitro through regulating epithelial-mesenchymal transition.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [38]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell adhesion Inhibition hsa04514
Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
In Vitro Model HEY cells Ovary Homo sapiens (Human) CVCL_0297
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
OV 1847 cells Breast Homo sapiens (Human) CVCL_D703
OVCA 420 cells Breast Homo sapiens (Human) CVCL_3935
In Vivo Model (NOD) /SCID nude mouse xenograft model .
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of TUBB3 is thought to result in resistance to taxanes is by enhancement of the dynamic instability of microtubules, thereby counteracting the activity of microtubule targeting agents. Transient restoration of miR-200c using miRNA mimics cause a significant decrease in TUBB3 levels, thus results in the resistance to taxanes.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Endometrial cancer [ICD-11: 2C76.1] [23]
Sensitive Disease Endometrial cancer [ICD-11: 2C76.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
In Vitro Model Hec50 cells Endometrium Homo sapiens (Human) CVCL_2929
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
ELISA assay
Mechanism Description Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3.
Sorafenib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [32]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
SN12C cells Kidney Homo sapiens (Human) CVCL_1705
ACHN cells Pleural effusion Homo sapiens (Human) CVCL_1067
786-O cells Kidney Homo sapiens (Human) CVCL_1051
Caki-1 cells Kidney Homo sapiens (Human) CVCL_0234
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description In the present study, we demonstrated the regulatory relationship between miR-200c and HO-1. We provided evidences to elucidate that miR-200c could sensitize ccRCC cells to sorafenib or imatinib to inhibit cell proliferation, at least partly by targeting HO-1. Moreover, the correlation between miR-200c and HO-1 expression level and drug resistance in ccRCC was also determined. Combined application with chemotherapeutic drugs, miR-200c, a HO-1 inhibitor, may enhance the efficiency of therapy by promoting both apoptosis and autophagy.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [39]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration
Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [40]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell growth Inhibition hsa05200
Cell metastasis Inhibition hsa05205
In Vitro Model U87MG cells Brain Homo sapiens (Human) CVCL_GP63
DBTRG-05MG cells Brain Homo sapiens (Human) CVCL_1169
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-200c overexpression in DBTRG cells was able to downregulate both PDHA1 and TIGAR, which are involved in OXPHOS and glycolysis regulation. PDHA1 was described as the major provider of carbon for the TCA in GB. miR-200c overexpression was able to decrease DBTRG cell mobility. The observed effect of miR-200c on the mobility of DBTRG cells could be attributed to miR-200c modulation of E-cadherin levels, and consequent repression of epithelial-mesenchymal transition (EMT).
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: HER2 positive breast cancer [ICD-11: 2C60.8] [41]
Resistant Disease HER2 positive breast cancer [ICD-11: 2C60.8]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
TGF-beta signaling pathway Regulation N.A.
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Lnc-ATB is up-regulated in TR breast cancer tissues and TR SkBR-3 cells. Up-regulation of lnc-ATB account for the trastuzumab resistance and high invasiveness of TR SkBR-3 cells. miR-200c is down-regulated and inverse correlated with lnc-ATB in TR breast cancer tissues and TR SkBR-3 cells. Lnc-ATB functions as a ceRNA by competitively biding miR-200c in TR SkBR-3 cells. Lnc-ATB up-regulates and positive correlates with ZEB1 and ZNF217 levels.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [42]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Trastuzumab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
TGF-Beta/ZEB1 signaling pathway Inhibition hsa04350
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-200c, which was the most significantly downregulated miRNA in trastuzumab-resistant cells, restored trastuzumab sensitivity and suppressed invasion of breast cancer cells by concurrently targeting ZNF217, a transcriptional activator of TGF-beta, and ZEB1, a known mediator of TGF-beta signaling. Restoration of miR-200c, silencing of ZEB1 or ZNF217 or blockade of TGF-beta signaling increased trastuzumab sensitivity and suppressed invasiveness of breast cancer cells.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [43]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [8]
Resistant Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Disease Class: Lung cancer [ICD-11: 2C25.5] [8]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Vincristine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Endometrial cancer [ICD-11: 2C76.1] [23]
Sensitive Disease Endometrial cancer [ICD-11: 2C76.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
In Vitro Model Hec50 cells Endometrium Homo sapiens (Human) CVCL_2929
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
ELISA assay
Mechanism Description Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3.
Clinical Trial Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Hydroxycamptothecin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [44]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Hydroxycamptothecin
Molecule Alteration Expression
.
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
SGC-7901 cells Gastric Homo sapiens (Human) CVCL_0520
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
AGS cells Gastric Homo sapiens (Human) CVCL_0139
Experiment for
Molecule Alteration
MiRNA microarray profiling, qRT-PCR
Experiment for
Drug Resistance
A sulforhodamine B (SRB) assay
Mechanism Description MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.
PD-0325901
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [45]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug PD-0325901
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MEK-EGFR-PI3K signalling pathway Regulation N.A.
In Vitro Model Panc1 cells Pancreas Homo sapiens (Human) CVCL_0480
CFPAC1 cells Pancreas Homo sapiens (Human) CVCL_1119
HPAF-II cells Pancreatic Homo sapiens (Human) CVCL_0313
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
In Vivo Model Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude) Mus musculus
Experiment for
Molecule Alteration
Western blot
Experiment for
Drug Resistance
Cell growth inhibition assays; Apoptosis analysis
Mechanism Description Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [1]
Resistant Disease Melanoma [ICD-11: 2C30.0]
Resistant Drug PLX4720
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model WM35 cells Skin Homo sapiens (Human) CVCL_0580
WM793 cells N.A. Homo sapiens (Human) CVCL_8787/CVCL_5414
WM35 cells Skin Homo sapiens (Human) CVCL_0580
1205Lu cells Skin Homo sapiens (Human) CVCL_5239
In Vivo Model NU/NU athymic nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Western blot
Experiment for
Drug Resistance
Cell Proliferation Assay; Cell Cycle Analysis; Colony Formation Assay
Mechanism Description Herein, we demonstrate that miR-200c is down-regulated in melanomas (primary and metastatic) compared with melanocytic nevi
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
U0126
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [1]
Resistant Disease Melanoma [ICD-11: 2C30.0]
Resistant Drug U0126
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model WM35 cells Skin Homo sapiens (Human) CVCL_0580
WM793 cells N.A. Homo sapiens (Human) CVCL_8787/CVCL_5414
WM35 cells Skin Homo sapiens (Human) CVCL_0580
1205Lu cells Skin Homo sapiens (Human) CVCL_5239
In Vivo Model NU/NU athymic nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Western blot
Experiment for
Drug Resistance
Cell Proliferation Assay; Cell Cycle Analysis; Colony Formation Assay
Mechanism Description Herein, we demonstrate that miR-200c is down-regulated in melanomas (primary and metastatic) compared with melanocytic nevi
References
Ref 1 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 2 The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cells. Mol Oncol. 2015 Oct;9(8):1678-93. doi: 10.1016/j.molonc.2015.04.015. Epub 2015 May 16.
Ref 3 Loss of miR-200c expression induces an aggressive, invasive, and chemoresistant phenotype in non-small cell lung cancer. Mol Cancer Res. 2010 Sep;8(9):1207-16. doi: 10.1158/1541-7786.MCR-10-0052. Epub 2010 Aug 9.
Ref 4 miR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy. Clin Cancer Res. 2009 Aug 15;15(16):5060-72. doi: 10.1158/1078-0432.CCR-08-2245. Epub 2009 Aug 11.
Ref 5 MicroRNA-200c reverses drug resistance of human gastric cancer cells by targeting regulation of the NER-ERCC3/4 pathway. Oncol Lett. 2019 Jul;18(1):145-152. doi: 10.3892/ol.2019.10304. Epub 2019 May 2.
Ref 6 A miR-200b/200c/429-binding site polymorphism in the 3' untranslated region of the AP-2Alpha gene is associated with cisplatin resistance. PLoS One. 2011;6(12):e29043. doi: 10.1371/journal.pone.0029043. Epub 2011 Dec 14.
Ref 7 The interactions between MicroRNA-200c and BRD7 in endometrial carcinoma. Gynecol Oncol. 2012 Jan;124(1):125-33. doi: 10.1016/j.ygyno.2011.09.026. Epub 2011 Oct 19.
Ref 8 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31. doi: 10.1007/s00280-011-1752-3. Epub 2011 Oct 13.
Ref 9 Overexpression of miR-200c induces chemoresistance in esophageal cancers mediated through activation of the Akt signaling pathway. Clin Cancer Res. 2011 May 1;17(9):3029-38. doi: 10.1158/1078-0432.CCR-10-2532. Epub 2011 Jan 19.
Ref 10 MiR-200c regulates tumor growth and chemosensitivity to cisplatin in osteosarcoma by targeting AKT2. Sci Rep. 2017 Oct 19;7(1):13598. doi: 10.1038/s41598-017-14088-3.
Ref 11 MicroRNA-200c regulates cisplatin resistance by targeting ZEB2 in human gastric cancer cells. Oncol Rep. 2017 Jul;38(1):151-158. doi: 10.3892/or.2017.5659. Epub 2017 May 22.
Ref 12 miR-200b and miR-200c co-contribute to the cisplatin sensitivity of ovarian cancer cells by targeting DNA methyltransferases. Oncol Lett. 2019 Feb;17(2):1453-1460. doi: 10.3892/ol.2018.9745. Epub 2018 Nov 22.
Ref 13 Circulating miR-200c levels significantly predict response to chemotherapy and prognosis of patients undergoing neoadjuvant chemotherapy for esophageal cancer. Ann Surg Oncol. 2013 Dec;20 Suppl 3:S607-15. doi: 10.1245/s10434-013-3093-4. Epub 2013 Jul 10.
Ref 14 MicroRNA-200c regulates the sensitivity of chemotherapy of gastric cancer SGC7901/DDP cells by directly targeting RhoE. Pathol Oncol Res. 2014 Jan;20(1):93-8. doi: 10.1007/s12253-013-9664-7. Epub 2013 Jul 3.
Ref 15 miR-200c regulates crizotinib-resistant ALK-positive lung cancer cells by reversing epithelial-mesenchymal transition via targeting ZEB1. Mol Med Rep. 2016 Nov;14(5):4135-4143. doi: 10.3892/mmr.2016.5770. Epub 2016 Sep 23.
Ref 16 BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
Ref 17 Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. Am J Pathol. 2012 Dec;181(6):2188-201. doi: 10.1016/j.ajpath.2012.08.011. Epub 2012 Oct 3.
Ref 18 miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
Ref 19 Down-regulation of microRNA-200c is associated with drug resistance in human breast cancer. Med Oncol. 2012 Dec;29(4):2527-34. doi: 10.1007/s12032-011-0117-4. Epub 2011 Nov 19.
Ref 20 miR-200c sensitizes breast cancer cells to doxorubicin treatment by decreasing TrkB and Bmi1 expression. PLoS One. 2012;7(11):e50469. doi: 10.1371/journal.pone.0050469. Epub 2012 Nov 29.
Ref 21 miRNA-200c increases the sensitivity of breast cancer cells to doxorubicin through the suppression of E-cadherin-mediated PTEN/Akt signaling. Mol Med Rep. 2013 May;7(5):1579-84. doi: 10.3892/mmr.2013.1403. Epub 2013 Mar 28.
Ref 22 E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cells. Int J Cancer. 2010 Jun 1;126(11):2575-83. doi: 10.1002/ijc.24972.
Ref 23 MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents. Mol Cancer Ther. 2009 May;8(5):1055-66. doi: 10.1158/1535-7163.MCT-08-1046. Epub 2009 May 12.
Ref 24 The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
Ref 25 The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151. doi: 10.1007/s12253-017-0222-6. Epub 2017 Apr 14.
Ref 26 Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104. doi: 10.1038/bjc.2013.655. Epub 2013 Oct 29.
Ref 27 A Bmi1-miRNAs cross-talk modulates chemotherapy response to 5-fluorouracil in breast cancer cells. PLoS One. 2013 Sep 9;8(9):e73268. doi: 10.1371/journal.pone.0073268. eCollection 2013.
Ref 28 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 29 miR-200c enhances sensitivity of drug-resistant non-small cell lung cancer to gefitinib by suppression of PI3K/Akt signaling pathway and inhibites cell migration via targeting ZEB1. Biomed Pharmacother. 2017 Jan;85:113-119. doi: 10.1016/j.biopha.2016.11.100. Epub 2016 Dec 5.
Ref 30 miR-200c overexpression is associated with better efficacy of EGFR-TKIs in non-small cell lung cancer patients with EGFR wild-type. Oncotarget. 2014 Sep 15;5(17):7902-16. doi: 10.18632/oncotarget.2302.
Ref 31 Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.
Ref 32 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 33 miR-200/ZEB axis regulates sensitivity to nintedanib in non-small cell lung cancer cells. Int J Oncol. 2016 Mar;48(3):937-44. doi: 10.3892/ijo.2016.3331. Epub 2016 Jan 11.
Ref 34 Long non-coding RNA LUCAT1 modulates methotrexate resistance in osteosarcoma via miR-200c/ABCB1 axis. Biochem Biophys Res Commun. 2018 Jan 1;495(1):947-953. doi: 10.1016/j.bbrc.2017.11.121. Epub 2017 Nov 21.
Ref 35 Over expression of miR-200c suppresses invasion and restores methotrexate sensitivity in lung cancer A549 cells. Gene. 2016 Nov 30;593(2):265-71. doi: 10.1016/j.gene.2016.07.038. Epub 2016 Jul 16.
Ref 36 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 37 A miRNA-200c/cathepsin L feedback loop determines paclitaxel resistance in human lung cancer A549 cells in vitro through regulating epithelial-mesenchymal transition. Acta Pharmacol Sin. 2018 Jun;39(6):1034-1047. doi: 10.1038/aps.2017.164. Epub 2017 Dec 7.
Ref 38 Restoration of miR-200c to ovarian cancer reduces tumor burden and increases sensitivity to paclitaxel. Mol Cancer Ther. 2012 Dec;11(12):2556-65. doi: 10.1158/1535-7163.MCT-12-0463. Epub 2012 Oct 16.
Ref 39 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 40 MiR-200c-based metabolic modulation in glioblastoma cells as a strategy to overcome tumor chemoresistance. Hum Mol Genet. 2021 Nov 16;30(23):2315-2331. doi: 10.1093/hmg/ddab193.
Ref 41 LncRNA-ATB promotes trastuzumab resistance and invasion-metastasis cascade in breast cancer. Oncotarget. 2015 May 10;6(13):11652-63. doi: 10.18632/oncotarget.3457.
Ref 42 MiR-200c suppresses TGF-Beta signaling and counteracts trastuzumab resistance and metastasis by targeting ZNF217 and ZEB1 in breast cancer. Int J Cancer. 2014 Sep 15;135(6):1356-68. doi: 10.1002/ijc.28782. Epub 2014 Mar 3.
Ref 43 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 44 MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.
Ref 45 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.