Molecule Information

General Information of the Molecule (ID: Mol01413)

• Name: hsa-mir-30b ,Homo sapiens
• Synonyms: microRNA 30b
• Molecule Type: Precursor miRNA
• Gene Name: MIR30B
• Gene ID: 407030
• Location: chr8:134800520-134800607[-]
• Sequence:
  ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGA
  GGUGGAUGUUUACUUCAGCUGACUUGGA
• Ensembl ID: ENSG00000207582
• HGNC ID: HGNC:31625
• Precursor Accession: MI0000441

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Activation; hsa04140
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA MALAT1 potentiates autophagy associated cisplatin resistance by suppressing the microRNA 30b/autophagy related gene 5 axis in gastric cancer.

References

• Ref 1: LncRNA MALAT1 potentiates autophagy associated cisplatin resistance by regulating the microRNA 30b/autophagy related gene 5 axis in gastric cancer. Int J Oncol. 2019 Jan;54(1):239-248. doi: 10.3892/ijo.2018.4609. Epub 2018 Oct 26.