Molecule Information

General Information of the Molecule (ID: Mol05095)

• Name: hsa-miR-101-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUUCUAAAGGUACAGUACUGUGAU
  AACUGAAGGAUGGCA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Fluorouracil

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vivo Model: Paired HCC tissues and adjacent non-tumor liver tissues model; female BALB/c athymic nude mice aged 4 to 6 weeks; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; Luciferase reporter assay; Immunofluorescence; Western blot
• Experiment for Drug Resistance: Cell proliferation assay,;Ccolony formation assay; Cell cycle analysis; Cell invasion assay; Apoptosis assay
• Mechanism Description: Tumor suppressor miR-101 represses HCC progression through directly targeting EZH2 oncogene and sensitizes liver cancer cells to chemotherapeutic treatment.

Bortezomib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Ubiquitin-proteasome pathway; Regulation; N.A.
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Mechanism Description: In ERalpha-positive breast cancers, miR-101 and POMP levels are inversely correlated, and high miR-101 expression or low POMP expression associates with prolonged survival. Mechanistically, miR-101 expression or POMP knockdown attenuated estrogen-driven transcription. Finally, suppressing POMP is sufficient to overcome tumor cell resistance to the proteasome inhibitor bortezomib.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [4]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cytotoxic Assay
• Mechanism Description: MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [6]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EMT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: TGF-beta/SMAD signalling pathway; Regulation; N.A.
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vivo Model: 4 to 6-week-old female non-obese mice with diabetes/severe combined immunodeficiency; Mus musculus
• Experiment for Molecule Alteration: Immunohistochemistry; qRT-PCR
• Experiment for Drug Resistance: Cell viability assays
• Mechanism Description: The in vitro drug sensitivity of pancreatic cancer cells was altered according to the miR-1246 expression via CCNG2.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: In this report, we proposed that miRNA-101 targets Jak2 mRNA and regulates its expression and induces K562 leukemia cell apoptosis. Here, we transduced the K562 cell line with a miR-101-overexpressing vector and evaluated the Jak2 mRNA level. Our results showed that miR-101 overexpression in Bcr-Abl+ cells reduced the Jak2 mRNA level. Moreover, imatinib treatment and miR-101 upregulation led to miR-23a overexpression, which has putative binding site(s) on 3'-untranslated regions (3'-UTRs) of STAT5, CCND1, and Bcl-2 genes. Our results also indicated that miR-101 overexpression inhibited cell proliferation indicated by the MTT assay and promoted apoptosis detected via flow cytometry. Importantly, mRNA expression of NF-kappa B-regulated anti-apoptotic (Bcl-2, Bcl-xl, MCL-1, XIAP, and survivin) and proliferative (c-Myc and CCND1) genes was decreased. These findings suggest that miR-101 acts as a tumor suppressor by downregulating Jak2 expression and sensitizing K562 cells to imatinib. Therefore, restoration of miR-101 may be a therapeutic approach for CML treatment.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [6]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• Experiment for Molecule Alteration: Micro Array Expression Analysis; qRT-PCR; Luciferase Reporter assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Micro-RNA profiles of paclitaxel resistant and paclitaxel sensitive A549 cells. The expression level of hsa-mir-101-1 has decreased.

Sirolimus

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [6]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Sirolimus
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Autophagy; Regulation; N.A.
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In the present study, we determined the involvement of autophagy during the chemotherapy of osteosarcoma cell line, U-2 OS, and further determined the regulation of miR-101 on the autophagy in the U-2 OS cells. Results demonstrated that doxorubicin treatment of U-2 OS cells induced significantly high level of autophagy-characteristic acidic vesicular organelles (AVOs), and induced significant autophagy related protein expression in U-2 OS cells. While the miR-101 could significantly reduce the doxorubicin-induced AVOs and block the autophagy related protein expression in U-2 OS cells. Moreover, the autophagy blockage by miR-101 sensitized the U-2 OS cells to doxorubicin treatment. In summary, miR-101 blocks autophagy during the chemotherapy in osteosarcoma cells and enhances chemosensitivity in vitro.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [8]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: Whole-genome screens
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: This gene is down-regulated in vincristine-resistance cells

References

• Ref 1: Metallo-Beta-lactamase expression confers an advantage to Pseudomonas aeruginosa isolates compared with other Beta-lactam resistance mechanisms, favoring the prevalence of metallo-Beta-lactamase producers in a clinical environment. Microb Drug Resist. 2010 Sep;16(3):223-30. doi: 10.1089/mdr.2010.0016.
• Ref 2: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 3: The Novel ATP-Competitive MEK/Aurora Kinase Inhibitor BI-847325 Overcomes Acquired BRAF Inhibitor Resistance through Suppression of Mcl-1 and MEK ExpressionMol Cancer Ther. 2015 Jun;14(6):1354-64. doi: 10.1158/1535-7163.MCT-14-0832. Epub 2015 Apr 14.
• Ref 4: miR-135a contributes to paclitaxel resistance in tumor cells both in vitro and in vivo. Oncogene. 2011 Oct 27;30(43):4386-98. doi: 10.1038/onc.2011.148. Epub 2011 May 9.
• Ref 5: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 6: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 7: Characterization of LY3023414, a Novel PI3K/mTOR Dual Inhibitor Eliciting Transient Target Modulation to Impede Tumor GrowthMol Cancer Ther. 2016 Oct;15(10):2344-2356. doi: 10.1158/1535-7163.MCT-15-0996. Epub 2016 Jul 20.
• Ref 8: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.