Molecule Information

General Information of the Molecule (ID: Mol05012)

• Name: hsa-miR-199a-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCAC
  AUUGGUUAGGC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/mTOR pathway; Regulation; N.A.
• Experiment for Molecule Alteration: Correlation analyses; Graphical model estimation for correlation networks
• Experiment for Drug Resistance: Data analysis
• Mechanism Description: miR-199a-1 downregulation confers cisplatin resistance by de-repressing mTOR and activating the PI3K/AKT/mTOR signaling pathway.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: YPEN-1 cells; Breast; Homo sapiens (Human); CVCL_0587
• Experiment for Molecule Alteration: Luciferase assay; Rescue assays; RT-PCR
• Experiment for Drug Resistance: Cell proliferation assays; Cell survival assays; Wound-healing assay
• Mechanism Description: We found that expression of miR-199a-3p promotes proliferation and survival of endothelial cells as well as breast cancer cells. Remarkably, miR-199a-3p inhibited both endogenous caveolin-2 activity and exogenous caveolin-2 activity, which was confirmed by a reporter construct bearing the 3'-untranslated region of caveolin-2. However, overexpression of caveolin-2 completely counteracted the enhancement of miR-199a-3p-mediated activities on cell proliferation, survival and sensitivity of tumor cells to anticancer drugs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CIS cells; Ovary; Homo sapiens (Human); CVCL_1942
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-qPCR; TaqMan assay; Northern blot analysis; Western blot; Luciferase assay
• Mechanism Description: A microarray platform optimised for the analysis of a panel of 381 human microRNA was used to analyse and compare the pattern of microRNAs expression between parental human ovarian cancer A2780wt cell line and its counterparts made resistant to cisplatin (A2780CIS) and paclitaxel (A2780TAX, resistance P-glycoprotein-dependent), and TC1/TC3, made resistant to paclitaxel in the presence of cyclosporine as inhibitor of P-glycoprotein. The expression of hsa-mir-199a-1 is decreased in drug-resistant cells.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [5]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [8]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cell Viability; Apoptosis Assay
• Mechanism Description: Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL.

Clinical Trial Drug(s) 1 drug(s) in total

Trichostatin A

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.02] [9]

• Sensitive Disease: Malignant glioma [ICD-11: 2A00.02]
• Sensitive Drug: Trichostatin A
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HL-60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay; Colony formation assay
• Mechanism Description: We show that in C42B prostate cancer cells, these miRNAs down-regulate GRP78 and induce apoptosis by directly targeting its 3' untranslated region. Importantly, we demonstrate that the three miRNAs act cooperatively to decrease GRP78 levels, suggesting that multiple miRNAs may be required to efficiently control the expression of some genes. In addition, delivery of multiple miRNAs by either transient transfection or lentivirus transduction increased the sensitivity of cancer cells to the histone deacetylase inhibitor, trichostatin A, in C42B, HCT116 and HL-60 cells.

References

• Ref 1: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 2: MicroRNA miR-199a-3p regulates cell proliferation and survival by targeting caveolin-2. J Cell Sci. 2011 Aug 15;124(Pt 16):2826-36. doi: 10.1242/jcs.077529.
• Ref 3: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 4: Role of microRNAs in drug-resistant ovarian cancer cells. Gynecol Oncol. 2008 Dec;111(3):478-86. doi: 10.1016/j.ygyno.2008.08.017. Epub 2008 Sep 26.
• Ref 5: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 6: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 7: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 8: BGB-283, a Novel RAF Kinase and EGFR Inhibitor, Displays Potent Antitumor Activity in BRAF-Mutated Colorectal CancersMol Cancer Ther. 2015 Oct;14(10):2187-97. doi: 10.1158/1535-7163.MCT-15-0262. Epub 2015 Jul 24.
• Ref 9: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.