Molecule Information

General Information of the Molecule (ID: Mol05001)

• Name: hsa-miR-203a ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GUGUUGGGGACUCGCGCGCUGGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGC
  AAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGGGCGCGGCGACAGCGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 10 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase reporter assay; Co-immunoprecipitation assay
• Experiment for Drug Resistance: MTS assay; FACS Analysis
• Mechanism Description: Here, we found Bmi1 overexpression in 5-Fu (5-fluorouracil)-resistant MCF-7 cells (MCF-7/5-Fu) derived from MCF-7 breast cancer cells, MDA-MB-231 and MDA-MB-453 breast cancer cells compared to MCF-7 cells, was related with 5-Fu resistance and enrichment of CD44+/CD24- stem cell subpopulation. Bmi1 knockdown enhanced the sensitivity of breast cancer cells to 5-Fu and 5-Fu induced apoptosis via mitochondrial apoptotic pathway, and decreased the fraction of CD44+/CD24- subpopulation. In addition, our analysis showed inverse expression pattern between Bmi1 and miR-200c and miR-203 in selected breast cancer cell lines, and miR-200c and miR-203 directly repressed Bmi1 expression in protein level confirmed by luciferase reporter assay. MiR-200c and miR-203 overexpression in breast cancer cells downregulated Bmi1 expression accompanied with reversion of resistance to 5-Fu mediated by Bmi1. Inversely, Bmi1 overexpression inhibited miR-200c expression in MCF-7 cells, but not miR-203, however ectopic wild-type p53 expression reversed Bmi1 mediated miR-200c downregulation, suggesting the repressive effect of Bmi1 on miR-200c maybe depend on p53. Thus, our study suggests a cross-talk between Bmi1 and miR-200c mediated by p53, and Bmi1 interference would improve chemotherapy efficiency in breast cancer via susceptive apoptosis induction and cancer stem cell enrichment inhibition.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [2]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [3]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual luciferase assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/beta-catenin signaling; Regulation; N.A.
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The most intriguing is the activation of Wnt/-catenin signaling in gemcitabine resistant NSCLC cell lines. The miR-155, miR-10a, miR-30a, miR-24-2* and miR-30c-2* were upregulated in sensitive cell lines, while expression of miR-200c, miR-203, miR-885-5p, miR-195 and miR-25* was increased in resistant cell line.

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [6]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR; Western blot
• Experiment for Drug Resistance: Cell proliferation and colony formation assay
• Mechanism Description: Selective inhibition of BCR/ABL expression by RNA interference has been demonstrated as an effective strategy in CML treatment and a reversal to imatinib resistance. microRNAs (miRNAs) are small regulatory RNAs involved in post-transcriptional gene regulation. miR-203 is supposed to directly regulate ABL and BCR/ABL expression, however, the role of miR-203 in imatinib-resistant cells is not clear. Here, we report that overexpression of miR-203 in BaF3-BCR/ABL cells with T315I mutant inhibited cell growth and colony formation ability. Furthermore, miR-203 increased sensitivity to imatinib in BaF3-BCR/ABLT315Icells, thereby antagonizing the main mechanism of resistance to imatinib.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [7]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR-203/AKT/MTDH; Regulation; N.A.
• Cell Pathway Regulation: HSP90; Regulation; N.A.
• Cell Pathway Regulation: Bcl-xL; Regulation; N.A.
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT15 cells; Colon; Homo sapiens (Human); CVCL_0292
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: Northern blot analysis; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay; Clonogenic assay;Cell proliferation assay; Cell apoptosis assay; Cell survival assay
• Mechanism Description: We further demonstrated that the tumor suppressive role of miR-203 was mediated by negatively regulating Akt2 protein expression through mRNA degradation. The inhibition of Akt2 activity downregulated the protein expression of its downstream molecules involved in chemoresistance, such as MTDH and HSP90 genes. Also, overexpression of miR-203 decreased anti-apoptotic gene Bcl-xL expression and increased apoptotic proteins Bax and active caspase-3 levels. Our study is the first to identify the tumor suppressive role of overexpressed miR-203, describe its associated signaling pathways, and highlight the role of miR-203 in chemoresistance.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray profiling, TaqMan Reverse Transcription (RT)-PCR for miRNA Quantification
• Experiment for Drug Resistance: Cell Proliferation Assay, Apoptosis Assay
• Mechanism Description: miRNA microarray analysis of MCF-7 cell lines that are either sensitive (parental) or resistant (4-hydroxytamoxifen-resistant (OHTR)) to tamoxifen showed significant (>1.8-fold) up-regulation of eight miRNAs and marked down-regulation (>50%) of seven miRNAs in OHTRcells compared with parental MCF-7 cells.

Temozolomide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [2]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vivo Model: Paired glioma and non-cancerous brain tissues model; Homo sapiens
• Experiment for Molecule Alteration: Immunohistochemical; qPCR; Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: MTS assay; Wound healing assay; Transwell cell invasion assay
• Mechanism Description: Recent data has suggested a profound role for microRNAs (miRs) in cancer progression. The present study demonstrated, via quantitative polymerase chain reaction (qPCR) analysis, that miR-203 expression was markedly lower in highly invasive U87MG glioma cells and glioma tissues. Wound healing and Transwell assays demonstrated that restoration of miR-203 expression inhibited U87MG cell migration and invasion. Restoration of miR-203 expression additionally sensitized the cells to temozolomide (TMZ) as determined by MTS assay. By contrast, miR-203 inhibition in A172 cells exerted opposite effects. Bioinformatic analysis combined with experimental analysis revealed that miR-203 directly targeted E2F3 via the conserved miR-203 target site within the E2F3 3'-untranslational region. E2F3 knockdown with specific small hairpin RNA also inhibited U87MG cell migration and invasion, and sensitized them to TMZ. Importantly, miR-203 and E2F3 showed inverse expression patterns in invasive glioma tissues, as demonstrated by qPCR and luciferase assay.

Investigative 1 drug(s) in total

Canertinib Dihydrochloride

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [9]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Canertinib Dihydrochloride
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; Western blot; Luciferase Assay; Immunohistochemistry assay
• Experiment for Drug Resistance: Cell death and Proliferation Assay
• Mechanism Description: Here we show that ectopic miR-203 expression displayed reduced bone metastasis and induced sensitivity to tyrosine kinase inhibitors (TKIs) treatment in a xenograft model. Our results demonstrate that the induction of bone metastasis and TKI resistance require miR-203 down regulation, activation of the EGFR pathway via altered expression of EGFR ligands (EREG and TGFA) and anti-apoptotic proteins (API5, BIRC2, and TRIAP1). Importantly, a sufficient reconstitution of invasiveness and resistance to TKIs treatment was observed in cells transfected with anti-miR-203. In prostate cancer patients, our data showed that miR-203 levels were inversely correlated with the expression of two EGFR ligands, EREG and TGFA, and an EGFR dependent gene signature. Our results support the existence of a miR-203, EGFR, TKIs resistance regulatory network in prostate cancer progression. We propose that the loss of miR-203 is a molecular link in the progression of prostate cancer metastasis and TKIs resistance characterized by high EGFR ligands output and anti-apoptotic proteins activation.

Investigative Drug(s) 1 drug(s) in total

Tyrphostin AG-1478

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [9]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Tyrphostin AG-1478
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; Western blot; Luciferase Assay; Immunohistochemistry assay
• Experiment for Drug Resistance: Cell death and Proliferation Assay
• Mechanism Description: Here we show that ectopic miR-203 expression displayed reduced bone metastasis and induced sensitivity to tyrosine kinase inhibitors (TKIs) treatment in a xenograft model. Our results demonstrate that the induction of bone metastasis and TKI resistance require miR-203 down regulation, activation of the EGFR pathway via altered expression of EGFR ligands (EREG and TGFA) and anti-apoptotic proteins (API5, BIRC2, and TRIAP1). Importantly, a sufficient reconstitution of invasiveness and resistance to TKIs treatment was observed in cells transfected with anti-miR-203. In prostate cancer patients, our data showed that miR-203 levels were inversely correlated with the expression of two EGFR ligands, EREG and TGFA, and an EGFR dependent gene signature. Our results support the existence of a miR-203, EGFR, TKIs resistance regulatory network in prostate cancer progression. We propose that the loss of miR-203 is a molecular link in the progression of prostate cancer metastasis and TKIs resistance characterized by high EGFR ligands output and anti-apoptotic proteins activation.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 3: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 4: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 5: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 6: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 7: miR-203 reverses chemoresistance in p53-mutated colon cancer cells through downregulation of Akt2 expression. Cancer Lett. 2011 May 1;304(1):52-9. doi: 10.1016/j.canlet.2011.02.003. Epub 2011 Feb 26.
• Ref 8: MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.
• Ref 9: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.