General Information of the Molecule (ID: Mol01727)
Name
hsa-miR-455-3p ,Homo sapiens
Synonyms
microRNA 455
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
GCAGUCCAUGGGCAUAUACAC
    Click to Show/Hide
Ensembl ID
ENSG00000207726
HGNC ID
HGNC:32344
Mature Accession
MIMAT0004784
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [1]
Resistant Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/beta-catenin/TGF-beta signaling pathway Activation hsa04310
In Vitro Model ECA-109 cells Esophagus Homo sapiens (Human) CVCL_6898
AGS cells Gastric Homo sapiens (Human) CVCL_0139
KYSE30 cells Esophagus Homo sapiens (Human) CVCL_1351
H157 cells Lung Homo sapiens (Human) CVCL_2458
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Tumor volume measurement; Luciferase assay
Mechanism Description Antagonizing miR455-3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Treatment with a miR455-3p antagomir dramatically chemosensitized ESCC cells and reduced the subpopulations of CD90+ and CD271+ T-ICs via deactivation of multiple stemness-associated pathways, including Wnt/beta-catenin and TGF-beta signaling.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [1]
Resistant Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/beta-catenin/TGF-beta signaling pathway Activation hsa04310
In Vitro Model ECA-109 cells Esophagus Homo sapiens (Human) CVCL_6898
AGS cells Gastric Homo sapiens (Human) CVCL_0139
KYSE30 cells Esophagus Homo sapiens (Human) CVCL_1351
H157 cells Lung Homo sapiens (Human) CVCL_2458
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Tumor volume measurement; Luciferase assay
Mechanism Description Antagonizing miR455-3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Treatment with a miR455-3p antagomir dramatically chemosensitized ESCC cells and reduced the subpopulations of CD90+ and CD271+ T-ICs via deactivation of multiple stemness-associated pathways, including Wnt/beta-catenin and TGF-beta signaling.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [2]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
HPDE6-C7 cells Pancreas Homo sapiens (Human) CVCL_0P38
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Down-regulation of microRNA-455-3p Links to Proliferation and Drug Resistance of Pancreatic Cancer Cells via Targeting TAZ.
References
Ref 1 Antagonizing miR-455-3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Mol Cancer. 2017 Jun 21;16(1):106. doi: 10.1186/s12943-017-0669-9.
Ref 2 Downregulation of MicroRNA-455-3p Links to Proliferation and Drug Resistance of Pancreatic Cancer Cells via Targeting TAZ. Mol Ther Nucleic Acids. 2018 Mar 2;10:215-226. doi: 10.1016/j.omtn.2017.12.002. Epub 2017 Dec 9.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.