Molecule Information

General Information of the Molecule (ID: Mol01727)

• Name: hsa-miR-455-3p ,Homo sapiens
• Synonyms: microRNA 455
• Molecule Type: Mature miRNA
• Sequence: GCAGUCCAUGGGCAUAUACAC
• Ensembl ID: ENSG00000207726
• HGNC ID: HGNC:32344
• Mature Accession: MIMAT0004784

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/beta-catenin/TGF-beta signaling pathway; Activation; hsa04310
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: KYSE30 cells; Esophagus; Homo sapiens (Human); CVCL_1351
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Tumor volume measurement; Luciferase assay
• Mechanism Description: Antagonizing miR455-3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Treatment with a miR455-3p antagomir dramatically chemosensitized ESCC cells and reduced the subpopulations of CD90+ and CD271+ T-ICs via deactivation of multiple stemness-associated pathways, including Wnt/beta-catenin and TGF-beta signaling.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/beta-catenin/TGF-beta signaling pathway; Activation; hsa04310
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: KYSE30 cells; Esophagus; Homo sapiens (Human); CVCL_1351
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Tumor volume measurement; Luciferase assay
• Mechanism Description: Antagonizing miR455-3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Treatment with a miR455-3p antagomir dramatically chemosensitized ESCC cells and reduced the subpopulations of CD90+ and CD271+ T-ICs via deactivation of multiple stemness-associated pathways, including Wnt/beta-catenin and TGF-beta signaling.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [2]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: HPDE6-C7 cells; Pancreas; Homo sapiens (Human); CVCL_0P38
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Down-regulation of microRNA-455-3p Links to Proliferation and Drug Resistance of Pancreatic Cancer Cells via Targeting TAZ.

References

• Ref 1: Antagonizing miR-455-3p inhibits chemoresistance and aggressiveness in esophageal squamous cell carcinoma. Mol Cancer. 2017 Jun 21;16(1):106. doi: 10.1186/s12943-017-0669-9.
• Ref 2: Downregulation of MicroRNA-455-3p Links to Proliferation and Drug Resistance of Pancreatic Cancer Cells via Targeting TAZ. Mol Ther Nucleic Acids. 2018 Mar 2;10:215-226. doi: 10.1016/j.omtn.2017.12.002. Epub 2017 Dec 9.