Molecule Information

General Information of the Molecule (ID: Mol01431)

• Name: hsa-mir-145 ,Homo sapiens
• Synonyms: microRNA 145
• Molecule Type: Precursor miRNA
• Gene Name: MIR145
• Gene ID: 406937
• Location: chr5:149430646-149430733[+]
• Sequence:
  CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCC
  UGGAAAUACUGUUCUUGAGGUCAUGGUU
• Ensembl ID: ENSG00000276365
• HGNC ID: HGNC:31532
• Precursor Accession: MI0000461

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 13 drug(s) in total

Cetuximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: EGFR/RAS/MAPK signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Northern blot analysis
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. restoration of miR-143 or miR-145 reduces the aggressiveness of mutant kRAS HCT116 cells. In addition, forced expression of these miRNAs in both mutant and wild-type kRAS colon cancer cells increased their sensitivity to cetuximab by increasing cetuximab-mediated ADCC. Moreover, increased levels of effector cell-mediated caspase-dependent apoptosis were observed for mutant kRAS HCT116 miRNAs-overexpressing cells.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Flow cytometry assay; Wound healing assay; Transwell assay; TUNEL assay
• Mechanism Description: Decreased expression of linc-ROR effectively reversed EMT in docetaxel-resistant LAD cells and sensitized them to chemotherapy. The function of linc-ROR exerted in LAD cells depended on the sponging of miR145, therefore, releasing the miR145 target FSCN1, and thus contributing to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant LAD cells.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-kb2 cells; Breast; Homo sapiens (Human); CVCL_6421
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-145 suppressed MRP1 expression by directly targeting MRP1 3'-untranslated regions. Overexpression of miR-145 sensitized breast cancer cells to doxorubicin in vitro and (+) to doxorubicin chemotherapy in vivo through inducing intracellular doxorubicin accumulation via inhibiting MRP1.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [6]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LS174T cells; Colon; Homo sapiens (Human); CVCL_1384
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Trypan blue assay; Sulforhodamine B assay
• Mechanism Description: Inhibition of SNAI2 directly with short hairpin sequence for SNAI2 and miR145 replacement therapy both decreased vimentin expression and increased in vitro 5FU sensitivity.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic adenocarcinoma [ICD-11: 2C10.4] [7]

• Sensitive Disease: Pancreatic adenocarcinoma [ICD-11: 2C10.4]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell migration assay
• Mechanism Description: miRNA-145 increases therapeutic sensibility to gemcitabine treatment of pancreatic adenocarcinoma cells, miR145 negatively regulated p70S6k1 expression at the posttranscriptional level in colon cancer.

Mitomycin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [8]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: C33A cells; Uterus; Homo sapiens (Human); CVCL_1094
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: p53 signalling pathway mediates the cytotoxic effects of chemotherapy, miR-145 augments p53-mediated cytotoxic effects.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [9]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116/L-OHP cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR145 inhibits drug resistance to L-OHP of HCT116 cells through suppressing the expression of target gene GPR98.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [10]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: A2780/PTX cells; Ovary; Homo sapiens (Human); CVCL_IJ13
• In Vitro Model: HOEC cells; Ovary; Homo sapiens (Human); N.A.
• In Vitro Model: SkOV3/PTX cells; Ovary; Homo sapiens (Human); CVCL_HF69
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-145 modulates the cellular response to anticancer drugs, Down-regulation of miR-145 is correlated with overexpression of Sp1 and Cdk6, Sp1 and Cdk6 are targets of miR-145, miR-145 downregulated P-gp and pRb through inhibition of Sp1 and Cdk6, miR-145 sensitized EOC cells to paclitaxel via Sp1 and Cdk6 inhibition, Overexpression of miR-145 enhanced paclitaxel sensitivity in vivo.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [11]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [12]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vivo Model: Balb/c athymic nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Microarray analysis; RT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: In this study, our miRNA/mRNA-microarray and RT-PCR analysis showed that the expression of miR145 (a tumor-suppressive miRNA) is inversely correlated with the levels of Oct4 and Sox2 in GBM-CD133+ cells and malignant glioma specimens. We demonstrated that miR145 negatively regulates GBM tumorigenesis by targeting Oct4 and Sox2 in GBM-CD133+. Using polyurethane-short branch polyethylenimine (PU-PEI) as a therapeutic-delivery vehicle, PU-PEI-mediated miR145 delivery to GBM-CD133+ significantly inhibited their tumorigenic and CSC-like abilities and facilitated their differentiation into CD133?-non-CSCs. Furthermore, PU-PEI-miR145-treated GBM-CD133+ effectively suppressed the expression of drug-resistance and anti-apoptotic genes and increased the sensitivity of the cells to radiation and temozolomide. Finally, the in vivo delivery of PU-PEI-miR145 alone significantly suppressed tumorigenesis with stemness, and synergistically improved the survival rate when used in combination with radiotherapy and temozolomide in orthotopic GBM-CD133+-transplanted immunocompromised mice. Therefore, PU-PEI-miR145 is a novel therapeutic approach for malignant brain tumors.

Vemurafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [13]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Vemurafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Established vemurafenib-resistant cell line colo205/V andfound that the miR-145 expression was significantly down-regulated in colo205/V cells compared to normal colo205cells. Moreover, the overexpression of miR-145 could in-crease the sensitivity of colo205/V cells to vemurafenib bothin vitro and in vivo.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [14]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: miR-143 or miR-145 overexpression increases cetuximab-mediated antibody-dependent cellular cytotoxicity in human colon cancer cells. Oncotarget. 2016 Feb 23;7(8):9368-87. doi: 10.18632/oncotarget.7010.
• Ref 2: MicroRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer. World J Gastroenterol. 2017 Apr 7;23(13):2337-2345. doi: 10.3748/wjg.v23.i13.2337.
• Ref 3: Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway. Oncotarget. 2017 May 16;8(20):33144-33158. doi: 10.18632/oncotarget.16562.
• Ref 4: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 5: miR-145 sensitizes breast cancer to doxorubicin by targeting multidrug resistance-associated protein-1. Oncotarget. 2016 Sep 13;7(37):59714-59726. doi: 10.18632/oncotarget.10845.
• Ref 6: SNAI2 modulates colorectal cancer 5-fluorouracil sensitivity through miR145 repression. Mol Cancer Ther. 2014 Nov;13(11):2713-26. doi: 10.1158/1535-7163.MCT-14-0207. Epub 2014 Sep 23.
• Ref 7: MiRNA-145 increases therapeutic sensibility to gemcitabine treatment of pancreatic adenocarcinoma cells. Oncotarget. 2016 Oct 25;7(43):70857-70868. doi: 10.18632/oncotarget.12268.
• Ref 8: Glucocorticoid regulation of a novel HPV-E6-p53-miR-145 pathway modulates invasion and therapy resistance of cervical cancer cells. J Pathol. 2012 Oct;228(2):148-57. doi: 10.1002/path.3997. Epub 2012 Apr 18.
• Ref 9: [MiR-145 inhibits drug resistance to Oxaliplatin in colorectal cancer cells through regulating G protein coupled receptor 98]. Zhonghua Wei Chang Wai Ke Za Zhi. 2017 May 25;20(5):566-570.
• Ref 10: miR-145 sensitizes ovarian cancer cells to paclitaxel by targeting Sp1 and Cdk6. Int J Cancer. 2014 Sep 15;135(6):1286-96. doi: 10.1002/ijc.28774. Epub 2014 Apr 28.
• Ref 11: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 12: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 13: Overexpression of miR-145 increases the sensitivity of vemurafenib in drug-resistant colo205 cell line. Tumour Biol. 2014 Apr;35(4):2983-8. doi: 10.1007/s13277-013-1383-x. Epub 2013 Nov 19.
• Ref 14: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.