Molecule Information
General Information of the Molecule (ID: Mol01431)
| Name |
hsa-mir-145
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 145
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR145
|
||||
| Gene ID | |||||
| Location |
chr5:149430646-149430733[+]
|
||||
| Sequence |
CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCC
UGGAAAUACUGUUCUUGAGGUCAUGGUU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| EGFR/RAS/MAPK signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
Northern blot analysis | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. restoration of miR-143 or miR-145 reduces the aggressiveness of mutant kRAS HCT116 cells. In addition, forced expression of these miRNAs in both mutant and wild-type kRAS colon cancer cells increased their sensitivity to cetuximab by increasing cetuximab-mediated ADCC. Moreover, increased levels of effector cell-mediated caspase-dependent apoptosis were observed for mutant kRAS HCT116 miRNAs-overexpressing cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [3] | |||
| Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Epithelial mesenchymal transition signaling pathway | Inhibition | hsa01521 | |
| In Vitro Model | SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay; Flow cytometry assay; Wound healing assay; Transwell assay; TUNEL assay | |||
| Mechanism Description | Decreased expression of linc-ROR effectively reversed EMT in docetaxel-resistant LAD cells and sensitized them to chemotherapy. The function of linc-ROR exerted in LAD cells depended on the sponging of miR145, therefore, releasing the miR145 target FSCN1, and thus contributing to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant LAD cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [4] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760). | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
| MDA-MB-453 cells | Breast | Homo sapiens (Human) | CVCL_0418 | |
| MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
| MCF10A cells | Breast | Homo sapiens (Human) | CVCL_0598 | |
| MDA-kb2 cells | Breast | Homo sapiens (Human) | CVCL_6421 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-145 suppressed MRP1 expression by directly targeting MRP1 3'-untranslated regions. Overexpression of miR-145 sensitized breast cancer cells to doxorubicin in vitro and (+) to doxorubicin chemotherapy in vivo through inducing intracellular doxorubicin accumulation via inhibiting MRP1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [6] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LS174T cells | Colon | Homo sapiens (Human) | CVCL_1384 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Trypan blue assay; Sulforhodamine B assay | |||
| Mechanism Description | Inhibition of SNAI2 directly with short hairpin sequence for SNAI2 and miR145 replacement therapy both decreased vimentin expression and increased in vitro 5FU sensitivity. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic adenocarcinoma [ICD-11: 2C10.4] | [7] | |||
| Sensitive Disease | Pancreatic adenocarcinoma [ICD-11: 2C10.4] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Transwell migration assay | |||
| Mechanism Description | miRNA-145 increases therapeutic sensibility to gemcitabine treatment of pancreatic adenocarcinoma cells, miR145 negatively regulated p70S6k1 expression at the posttranscriptional level in colon cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [8] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Mitomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | p53 signaling pathway | Activation | hsa04115 | |
| In Vitro Model | C33A cells | Uterus | Homo sapiens (Human) | CVCL_1094 |
| Experiment for Molecule Alteration |
RT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | p53 signalling pathway mediates the cytotoxic effects of chemotherapy, miR-145 augments p53-mediated cytotoxic effects. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [9] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCT116/L-OHP cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR145 inhibits drug resistance to L-OHP of HCT116 cells through suppressing the expression of target gene GPR98. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [10] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| MCF-7/ADM cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| A2780/PTX cells | Ovary | Homo sapiens (Human) | CVCL_IJ13 | |
| HOEC cells | Ovary | Homo sapiens (Human) | N.A. | |
| SkOV3/PTX cells | Ovary | Homo sapiens (Human) | CVCL_HF69 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-145 modulates the cellular response to anticancer drugs, Down-regulation of miR-145 is correlated with overexpression of Sp1 and Cdk6, Sp1 and Cdk6 are targets of miR-145, miR-145 downregulated P-gp and pRb through inhibition of Sp1 and Cdk6, miR-145 sensitized EOC cells to paclitaxel via Sp1 and Cdk6 inhibition, Overexpression of miR-145 enhanced paclitaxel sensitivity in vivo. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [11] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Vemurafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Established vemurafenib-resistant cell line colo205/V andfound that the miR-145 expression was significantly down-regulated in colo205/V cells compared to normal colo205cells. Moreover, the overexpression of miR-145 could in-crease the sensitivity of colo205/V cells to vemurafenib bothin vitro and in vivo. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
