General Information of the Molecule (ID: Mol01425)
Name
hsa-mir-138 ,Homo sapiens
Synonyms
microRNA 138-2
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR138-2
Gene ID
406930
Location
chr16:56858518-56858601[+]
Sequence
CGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUA
UUUCACGACACCAGGGUUGCAUCA
    Click to Show/Hide
Ensembl ID
ENSG00000207649
HGNC ID
HGNC:31525
Precursor Accession
MI0000455
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
miR138/EZH2 signaling pathway Regulation N.A.
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HOS cells Bone Homo sapiens (Human) CVCL_0312
In Vivo Model BALB/c nu/nu nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-138 acts as a tumor suppressor in osteosarcoma, inhibiting cell proliferation, migration, and invasion by downregulating EZH2 expression. Mir-138 overexpression also enhances osteosarcoma cell chemosensitivity to cisplatin by targeting EZH2.
Disease Class: Leukemia [ICD-11: 2B33.6] [2]
Sensitive Disease Leukemia [ICD-11: 2B33.6]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration
qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-138 was found up-regulated in the vincristine-induced multidrug resistance (MDR) leukemia cell line HL-60/VCR as compared with HL-60 cells. Up-regulation of miR-138 could reverse resistance of both P-glycoprotein-related and P-glycoprotein-non-related drugs on HL-60/VCR cells, and promote adriamycin-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of adriamycin.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
ERK signaling pathway Regulation N.A.
RhoC/FAKT/Src/ROCK2 signaling pathways Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H23 cells Lung Homo sapiens (Human) CVCL_1547
In Vivo Model CB-17 SCID Mus musculus(Mouse) Orthotopic breast tumor model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-138 sensitizes NSCLC cells to ADM through regulation of EMT regulator ZEB2. Ectopic expression of miR-138 decreased ZEB2 expression and inhibited the luciferase activity in chemoresistant tumor cells, suggesting that miR-138 could regulate EMT, at least partly, through targeting ZEB2 in NSCLC cells.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [4]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Promega viability kit assay
Mechanism Description Down-regulated of FAk increased sensitivity of HeLa cancer cells to Fluorouracil chemotherapy, targeting and down-regulation of FAk expression by miR-135 and miR-138, overexpressed miR-138 and miR-135 had increased sensitivity to chemotherapy.
Disease Class: Leukemia [ICD-11: 2B33.6] [2]
Sensitive Disease Leukemia [ICD-11: 2B33.6]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration
qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-138 was found up-regulated in the vincristine-induced multidrug resistance (MDR) leukemia cell line HL-60/VCR as compared with HL-60 cells. Up-regulation of miR-138 could reverse resistance of both P-glycoprotein-related and P-glycoprotein-non-related drugs on HL-60/VCR cells, and promote adriamycin-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of adriamycin.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [ICD-11: 2C77.0] [4]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Promega viability kit assay
Mechanism Description Down-regulated of FAk increased sensitivity of HeLa cancer cells to Fluorouracil chemotherapy, targeting and down-regulation of FAk expression by miR-135 and miR-138, overexpressed miR-138 and miR-135 had increased sensitivity to chemotherapy.
Disease Class: Leukemia [ICD-11: 2B33.6] [2]
Sensitive Disease Leukemia [ICD-11: 2B33.6]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration
qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-138 was found up-regulated in the vincristine-induced multidrug resistance (MDR) leukemia cell line HL-60/VCR as compared with HL-60 cells. Up-regulation of miR-138 could reverse resistance of both P-glycoprotein-related and P-glycoprotein-non-related drugs on HL-60/VCR cells, and promote adriamycin-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of adriamycin.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [5]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Gefitinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
PC9 cells Lung Homo sapiens (Human) CVCL_B260
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-138 inhibit the protein level of EGFR and reverses gefitinib resistance in lung cancer cells.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [6]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
miR138/BIM signaling pathway Regulation N.A.
In Vitro Model LN229 cells Brain Homo sapiens (Human) CVCL_0393
A172 cells Brain Homo sapiens (Human) CVCL_0131
LN-18 cells Brain Homo sapiens (Human) CVCL_0392
T98G cells Brain Homo sapiens (Human) CVCL_0556
U87MG cells Brain Homo sapiens (Human) CVCL_GP63
LN308 cells Brain Homo sapiens (Human) CVCL_0394
D247MG cells Brain Homo sapiens (Human) CVCL_1153
LN-319 cells Brain Homo sapiens (Human) CVCL_3958
LN-428 cells Brain Homo sapiens (Human) CVCL_3959
In Vivo Model BALB/c nu/nu nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue dye exclusion assay
Mechanism Description Transient transfection of miR-138 mimics in glioma cells with low basal miR-138 expression increased glioma cell proliferation. Moreover, miR-138 overexpression increased TMZ resistance in long-term glioblastoma cell lines and glioma initiating cell cultures. The apoptosis regulator BIM was identified as a direct target of miR-138, and its silencing mediated the induced TMZ resistance phenotype.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [ICD-11: 2B33.6] [2]
Sensitive Disease Leukemia [ICD-11: 2B33.6]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration
qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-138 was found up-regulated in the vincristine-induced multidrug resistance (MDR) leukemia cell line HL-60/VCR as compared with HL-60 cells. Up-regulation of miR-138 could reverse resistance of both P-glycoprotein-related and P-glycoprotein-non-related drugs on HL-60/VCR cells, and promote adriamycin-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of adriamycin.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [7]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
HLCZ01 cells Hepatoma Homo sapiens (Human) CVCL_1J92
LH86 cells Hepatoma Homo sapiens (Human) CVCL_8889
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-138 enhances TRAIL-induced apoptosis through interferon-stimulated gene 15 downregulation in hepatocellular carcinoma cells.
References
Ref 1 MiR-138 Acts as a Tumor Suppressor by Targeting EZH2 and Enhances Cisplatin-Induced Apoptosis in Osteosarcoma Cells. PLoS One. 2016 Mar 28;11(3):e0150026. doi: 10.1371/journal.pone.0150026. eCollection 2016.
Ref 2 miR-138 might reverse multidrug resistance of leukemia cells. Leuk Res. 2010 Aug;34(8):1078-82. doi: 10.1016/j.leukres.2009.10.002. Epub 2009 Nov 6.
Ref 3 MicroRNA-138 regulates chemoresistance in human non-small cell lung cancer via epithelial mesenchymal transition. Eur Rev Med Pharmacol Sci. 2016;20(6):1080-6.
Ref 4 MiR-138 and MiR-135 directly target focal adhesion kinase, inhibit cell invasion, and increase sensitivity to chemotherapy in cancer cells. Anticancer Agents Med Chem. 2014 Jan;14(1):18-28. doi: 10.2174/187152061401140108113435.
Ref 5 HOXA4-regulated miR-138 suppresses proliferation and gefitinib resistance in non-small cell lung cancer. Mol Genet Genomics. 2019 Feb;294(1):85-93. doi: 10.1007/s00438-018-1489-3. Epub 2018 Sep 8.
Ref 6 MicroRNA-138 promotes acquired alkylator resistance in glioblastoma by targeting the Bcl-2-interacting mediator BIM. Oncotarget. 2016 Mar 15;7(11):12937-50. doi: 10.18632/oncotarget.7346.
Ref 7 MicroRNA-138 enhances TRAIL-induced apoptosis through interferon-stimulated gene 15 downregulation in hepatocellular carcinoma cells. Tumour Biol. 2017 Jun;39(6):1010428317710410. doi: 10.1177/1010428317710410.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.