Molecule Information

General Information of the Molecule (ID: Mol01417)

• Name: hsa-mir-125b-1 ,Homo sapiens
• Synonyms: microRNA 125b-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR125B1
• Gene ID: 406911
• Location: chr11:122099757-122099844[-]
• Sequence:
  UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGU
  UAGGCUCUUGGGAGCUGCGAGUCGUGCU
• Ensembl ID: ENSG00000207971
• HGNC ID: HGNC:31506
• Precursor Accession: MI0000446

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 13 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT20 cells; Breast; Homo sapiens (Human); CVCL_0178
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue dye exclusion assays
• Mechanism Description: Among the miRNAs tested, only miR-125b was significantly associated with therapeutic response, exhibiting higher expression level in non-responsive patients (n = 26, 46%; p = 0.008). In addition, breast cancers with high miR-125b expression had higher percentage of proliferating cells and lower percentage of apoptotic cells in the corresponding surgical specimens obtained after neoadjuvant chemotherapy. Increased resistance to anticancer drug was observed in vitro in breast cancer cells with ectopic miR-125b expression; conversely, reducing miR-125b level sensitized breast cancer cells to chemotherapy. Moreover, we demonstrated that the E2F3 was a direct target of miR-125b in breast cancer cells.

Bortezomib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Peripheral T-cell lymphoma [ICD-11: 2A90.5] [3]

• Sensitive Disease: Peripheral T-cell lymphoma [ICD-11: 2A90.5]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: cMyc/miR-125b-5p; Regulation; N.A.
• In Vitro Model: MyLa2000 cells; Skin; Homo sapiens (Human); CVCL_8328
• In Vitro Model: SeAx cells; Skin; Homo sapiens (Human); CVCL_5363
• In Vivo Model: NOD SCID gamma (NSG) mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Chromatin Immunoprecipitation Assay; Western blot
• Experiment for Drug Resistance: Apoptosis Assessment
• Mechanism Description: Using cutaneous T-cell lymphoma (CTCL) as a model of the chemotherapy-resistant peripheral lymphoid malignancy, we demonstrated that resistance to proteasome inhibition involved a signaling between the oncogene cMyc and miR-125b-5p. Bortezomib repressed cMyc and simultaneously induced miR-125b-5p that exerted a cytoprotective effect through the downmodulation of MAD4. Overexpression of cMyc repressed miR-125b-5p transcription and sensitized lymphoma cells to bortezomib. The central role of miR-125b-5p was further confirmed in a mouse model of T-cell lymphoma, where xenotransplantation of human CTCL cells overexpressing miR-125b-5p resulted in enhanced tumor growth and a shorter median survival. Our findings describe a novel mechanism through which miR-125b-5p not only regulates tumor growth in vivo, but also increases cellular resistance to proteasome inhibitors via modulation of MAD4.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [4]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Dexamethasone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [ICD-11: 2A83.0] [3]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Dexamethasone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53/miR-34a/SIRT1 signaling pathway; Regulation; N.A.
• Experiment for Molecule Alteration: RT-qPCR; Chemiluminescent reporter gene assay; Western blot
• Experiment for Drug Resistance: Luminescent cell death analysis
• Mechanism Description: In summary, dexamethasone-induced miR-125b induces cell death resistance mechanisms in MM cells via the p53/miR-34a/SIRT1 signaling network and provides these cells with an enhanced level of resistance to cytotoxic chemotherapeutics.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ?MAPK signaling pathway; Regulation; N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The qRT-PCR results demonstrated that compared to the parental MCF-7 cell line, miR-200a, miR-141, miR-200c, miR-31, miR-429, and miR-196b were over-expressed, and let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760 were significantly down-regulated in MCF-7/Adr cells. The GO analysis results revealed that the predicted target genes of these 14 miRNAs primarily regulated protein binding, zinc ion binding, DNA binding, and transcription factor activity. The KEGG data demonstrated that these target genes are mainly involved in the MAPK signaling pathway, regulation of the actin cytoskeleton, cytokine-cytokine receptor interaction, and other signaling pathways.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [6]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Luminescence-based cell viability analysis
• Mechanism Description: However, it certainly is of interest to highlight the possible involvement of such miRNAs in affecting the most common means of chemoresistance-inducing cellular pathways within such cell lines. A typical example would be the effect of such miRNAs on the ABC transporter system and its member genes that regulate drug efflux properties of the cell.

Gemcitabine

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: Snail confers chemoresistance by repressing Bak1 through up-regulation of miR-125b. Restoring the expression of Bak1 or depleting miR-125b re-sensitizes Snail-expressing cancer cells to Taxol, indicating that miR-125b is critical in Snail-induced chemoresistance. Moreover, overexpression of miR-125b significantly increases the cancer stem cell population (CD24-CD44+), while depletion of miR-125b or rescue of the expression of Bak1 increases the non-stem cell population (CD24+CD44+) in Snail-overexpressing cells.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [7]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CIS cells; Ovary; Homo sapiens (Human); CVCL_1942
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-qPCR; TaqMan assay; Northern blot analysis; Western blot; Luciferase assay
• Mechanism Description: A microarray platform optimised for the analysis of a panel of 381 human microRNA was used to analyse and compare the pattern of microRNAs expression between parental human ovarian cancer A2780wt cell line and its counterparts made resistant to cisplatin (A2780CIS) and paclitaxel (A2780TAX, resistance P-glycoprotein-dependent), and TC1/TC3, made resistant to paclitaxel in the presence of cyclosporine as inhibitor of P-glycoprotein. The expression of hsa-mir-125b-1 is elevated in drug-resistant cells.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [9]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: miR-125b-2 is overexpressed in glioblastoma multiforme tissues and the corresponding stem cells (GBMSC); downregulation of miR-125b-2 expression in GBMSC could allow TMZ to induce GBMSC apoptosis. Additionally, the expression of the anti-apop totic protein Bcl-2 was decreased after the TMZ+miR-125b-2 inhibitor treatment, while the expression of the proapoptotic protein Bax was increased. Further research demonstrated that the induction of apoptosis in GBMSC is also associated with increased cytochrome c release from mitochondria, induction of Apaf-1, activation of caspase-3 and poly-ADP-ribose polymerase(PARP). Taken together, these results suggest that miR-125b-2 overexpression might confer glioblastoma stem cells resistance to TMZ.

Vemurafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [ICD-11: 2C30.0] [10]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Vemurafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Melanoma patients; Homo sapiens
• Experiment for Molecule Alteration: Microarray profiling; Immunostaining; qRT-PCR
• Experiment for Drug Resistance: MTT colorimetric assays
• Mechanism Description: Vemurafenib treatment increased the CCL2 levels in plasma, whereas the long-term clinical response was associated with low CCL2 levels.Increased CCL2 production was associated with miRNA deregulation in the resistant cells. miR-34a, miR-100 and miR-125b showed high expression in both resistant cells and in tumor biopsies that were obtained from treated patients, and they were involved in the control of cell proliferation and apoptosis. Inhibition of CCL2 and of the selected miRNAs restored both the cell apoptosis and the drug efficacy in resistant melanoma cells.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [11]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [4]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Investigative 1 drug(s) in total

Mafosfamide Sodium Salt

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [3]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Mafosfamide Sodium Salt
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• Experiment for Molecule Alteration: qRT-PCR; Western blot
• Experiment for Drug Resistance: Chemosensitivity assay
• Mechanism Description: We found miR-125b to be upregulated in two different Dox-resistant EWS cell lines. The upregulation of miR-125b was also confirmed in the EWS tumors having survived chemotherapy regimen which includes doxorubicin. When miR-125b was knocked down in EWS cells, both the Dox-resistant and parental cells showed an enhanced sensitivity to doxorubicin, which was associated with the upregulation of the pro-apoptotic molecules, p53 and Bak. Inversely, the overexpression of miR-125b in parental EWS cells resulted in enhanced drug resistance, not only to doxorubicin, but also to etoposide and vincristine.

References

• Ref 1: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 2: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 3: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 4: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 5: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 6: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 7: Role of microRNAs in drug-resistant ovarian cancer cells. Gynecol Oncol. 2008 Dec;111(3):478-86. doi: 10.1016/j.ygyno.2008.08.017. Epub 2008 Sep 26.
• Ref 8: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 9: MicroRNA-125b-2 confers human glioblastoma stem cells resistance to temozolomide through the mitochondrial pathway of apoptosis. Int J Oncol. 2012 Jan;40(1):119-29. doi: 10.3892/ijo.2011.1179. Epub 2011 Aug 29.
• Ref 10: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.
• Ref 11: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.