General Information of the Molecule (ID: Mol01416)
Name
hsa-mir-125b ,Homo sapiens
Synonyms
microRNA 125b-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR125B1
Gene ID
406911
Location
chr11:122099757-122099844[-]
Sequence
UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGU
UAGGCUCUUGGGAGCUGCGAGUCGUGCU
    Click to Show/Hide
Ensembl ID
ENSG00000207971
HGNC ID
HGNC:31506
Precursor Accession
MI0000446
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
13 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
RkO cells Colon Homo sapiens (Human) CVCL_0504
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
NCI-H508 cells Colon Homo sapiens (Human) CVCL_1564
SW1116 cells Colon Homo sapiens (Human) CVCL_0544
COLO 320DM cells Colon Homo sapiens (Human) CVCL_0219
HCT15 cells Colon Homo sapiens (Human) CVCL_0292
LS174T cells Colon Homo sapiens (Human) CVCL_1384
NCI-H716 cells Colon Homo sapiens (Human) CVCL_1581
SW948 cells Colon Homo sapiens (Human) CVCL_0632
SW403 cells Colon Homo sapiens (Human) CVCL_0545
SW48 cells Colon Homo sapiens (Human) CVCL_1724
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
HuTu80 cells Small intestine Homo sapiens (Human) CVCL_1301
LS123 cells Colon Homo sapiens (Human) CVCL_1383
SK-CO-1 cells Colon Homo sapiens (Human) CVCL_0626
SW837 cells Colon Homo sapiens (Human) CVCL_1729
T84 cells Colon Homo sapiens (Human) CVCL_0555
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
Luciferase reporter assay; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR100 and miR125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
GIST-T1 cells Gastric Homo sapiens (Human) CVCL_4976
CAL62 cells Thyroid gland Homo sapiens (Human) CVCL_1112
CAL-62 cells Thyroid gland Homo sapiens (Human) CVCL_1112
CCL-131 cells Brain Mus musculus (Mouse) CVCL_0470
COLO320DM cells Colon Homo sapiens (Human) CVCL_0219
CT26 WT cells Colon Mus musculus (Mouse) CVCL_7256
Detroit562 cells Pleural effusion Homo sapiens (Human) CVCL_1171
DIPG 007 cells Brain Homo sapiens (Human) CVCL_VU70
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
DU145 cells Prostate Homo sapiens (Human) CVCL_0105
FL83B cells Liver Mus musculus (Mouse) CVCL_4691
GH3 cells Pituitary gland Rattus norvegicus (Rat) CVCL_0273
GH4C1 cells pituitary gland Rattus norvegicus (Rat) CVCL_0276
H1650 cells Pleural effusion Homo sapiens (Human) CVCL_4V01
H9 cells Peripheral blood Homo sapiens (Human) CVCL_1240
H9/HTLV cells Peripheral blood Homo sapiens (Human) CVCL_3514
HEK 293T cells Kidney Homo sapiens (Human) CVCL_0063
HeLa S cells Uterus Homo sapiens (Human) CVCL_0058
HeLa229 cells Uterus Homo sapiens (Human) CVCL_1276
HH cells Peripheral blood Homo sapiens (Human) CVCL_1280
HPrEC cells Prostate Homo sapiens (Human) CVCL_A2EM
Human RPMI8226 myeloma cells Peripheral blood Homo sapiens (Human) CVCL_0014
KB-C2 cells Uterus Homo sapiens (Human) CVCL_D600
Experiment for
Molecule Alteration
RT-PCR
Mechanism Description miR-100HG, miR-100 and miR-125b overexpression was also observed in cetuximab-resistant colorectal cancer and head and neck squamous cell cancer cell lines and in tumors from colorectal cancer patients that progressed on cetuximab. miR-100 and miR-125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [2]
Resistant Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
p53 signaling pathway Inhibition hsa04115
In Vitro Model CNE1 cells Throat Homo sapiens (Human) CVCL_6888
CNE-2 cells Nasopharynx Homo sapiens (Human) CVCL_6888
TW03 cells Nasopharynx Homo sapiens (Human) CVCL_6010
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description In the TW03/DDP cells, the expression levels of miR 125a and miR 125b were upregulated, and this caused downregulation of p53. Ectopic expression of these miRNAs in the TW03 cell model sensitized TW03 to cisplatin by decreasing the protein expression levels of p53, whereas ectopic expression in the antisense oligos of these microRNAs demonstrated the opposite effect. In addition, the present demonstrated that the cisplatin induced expression of miR 125a and miR 125b inhibited cisplatin induced apoptosis in the TW03 cells by decreasing the protein expression levels of p53. Taken together, the present study revealed for the first time, to the best of our knowledge, that induction of the expression of miR 125a and miR 125b by treatment with cisplatin resulted in resistance to the cisplatin drug in the NPC cells.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Bak1 was a direct target of miR-125b, and down-regulation of Bak1 suppressed cisplatin-induced apoptosis and led to an increased resistance to cisplatin. miR-125b has a sig-nificantly promoting effect on chemoresistance of C13* cells and up-regulation of miR-125b expression contributes to cisplatin resistance through suppression of Bak1 expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [4]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model CNE2 cells Nasopharynx Homo sapiens (Human) CVCL_6889
CNE2/DDP cells Nasopharynx Homo sapiens (Human) CVCL_6889
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay-directed annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) assay
Mechanism Description microRNA-125b reverses the multidrug resistance of nasopharyngeal carcinoma cells via targeting of Bcl-2.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Overexpression of miR-125b improved the chemosensitivity of DDP in HGC-27 and MGC-803 cells and miR-125b obviously inhibited the expression of HER2 at protein level in HGC-27 and MGC-803 cells.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [6]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
p53/p38/MAPK signaling pathway Regulation N.A.
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HOS cells Bone Homo sapiens (Human) CVCL_0312
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Overexpression of miR-125b inhibited proliferation, migration, and invasion of OS cells and reduced the chemotherapy resistance of OS cells to cisplatin by targeting Bcl-2.
Cyclophosphamide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [7], [8]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Inhibition hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT20 cells Breast Homo sapiens (Human) CVCL_0178
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Sphere formation assay
Mechanism Description E2F3, and in some settings E2F1, induce apoptosis through p53-dependent or -independent pathways, Overexpression of miR-125b in MCF-7 cells significantly down-regulated E2F3 protein level, overexpression of miR-125b caused a marked inhibition of anticancer drug activity and increased resistance in breast cancer cells in vitro. And elevated miR-125b expression in chemoresistant cancer cells were due to high percentage of SP cells.
Daunorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [ICD-11: 2B33.6] [9]
Resistant Disease Leukemia [ICD-11: 2B33.6]
Resistant Drug Daunorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model THP-1 cells Blood Homo sapiens (Human) CVCL_0006
Jurkat cells Pleural effusion Homo sapiens (Human) CVCL_0065
K562 cells Blood Homo sapiens (Human) CVCL_0004
REH cells Bone marrow Homo sapiens (Human) CVCL_1650
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Luminescent cell viability assay
Mechanism Description miR-125b downregulated GRk2 and PUMA, which inhibited apoptosis and induced leukemia cell resistance to DNR.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [10]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).
Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [11]
Resistant Disease Ewing sarcoma [ICD-11: 2B52.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR125b-p53/BAKT signaling pathway Activation hsa05206
In Vitro Model RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
VH-64 cells Bones Homo sapiens (Human) CVCL_9672
WE-68 cells Bones Homo sapiens (Human) CVCL_9717
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-glo luminescent cell viability assay
Mechanism Description miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.
Disease Class: Primitive neuroectodermal tumor [ICD-11: 2A00.08] [11]
Resistant Disease Primitive neuroectodermal tumor [ICD-11: 2A00.08]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR125b-p53/BAKT signaling pathway Activation hsa05206
In Vitro Model RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
VH-64 cells Bones Homo sapiens (Human) CVCL_9672
WE-68 cells Bones Homo sapiens (Human) CVCL_9717
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-glo luminescent cell viability assay
Mechanism Description miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.
Disease Class: Acute promyelocytic leukemia [ICD-11: 2A60.2] [12]
Resistant Disease Acute promyelocytic leukemia [ICD-11: 2A60.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
NB4 cells Bone marrow Homo sapiens (Human) CVCL_0005
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-125b could promote leukemic cell proliferation and inhibit cell apoptosis by regulating the expression of tumor suppressor BCL2-antagonist/killer 1 (Bak1). transfection of a miR-125b duplex into AML cells can increase their resistance to therapeutic drugs.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [13]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR125b/HAX1 signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Enforced expression of miR-125b resensitizes MCF-7/R cells to DOX via downregulation of HAX-1.
Disease Class: Chondrosarcoma [ICD-11: 2B50.0] [14]
Sensitive Disease Chondrosarcoma [ICD-11: 2B50.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Glucose metabolism signaling pathway Regulation N.A.
In Vitro Model CH-2879 cells Bone Homo sapiens (Human) CVCL_9921
OUMS-27 cells Bone Homo sapiens (Human) CVCL_3090
SW1353 cells Bone Homo sapiens (Human) CVCL_0543
CS-1 cells Bone Homo sapiens (Human) CVCL_T023
CSPG cells Bone Homo sapiens (Human) N.A.
JJ012 cells Bone Homo sapiens (Human) CVCL_D605
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-125b was downregulated in chondrosarcoma cells compared with normal human chondrocytes. More importantly, miR-125b was downregulated in doxorubicin resistant cancer cells, with its overexpression enhancing doxorubicin-induced cytotoxicity and apoptosis, subsequently increasing the sensitivity of chondrosarcoma cells to doxorubicin. ErbB2 was a direct target of miR-125b in chondrosarcoma cells. The inhibition of ErbB2 by overexpression of miR-125b led to suppression of glucose metabolism, which rendered chondrosarcoma cells susceptible to doxorubicin. Restoring the expression of ErbB2 and glucose metabolic enzymes recovered doxorubicin resistance in counteracting miR-125b-mediated sensitivity. Taken together, miR-125b plays a critical role in doxorubicin resistance through suppression of ErbB2-induced glucose metabolism, and it may serve as a potential target for overcoming chemoresistance in human chondrosarcoma.
Disease Class: Chondrosarcoma [ICD-11: 2B50.0] [14]
Sensitive Disease Chondrosarcoma [ICD-11: 2B50.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model CH-2879 cells Bone Homo sapiens (Human) CVCL_9921
OUMS-27 cells Bone Homo sapiens (Human) CVCL_3090
SW1353 cells Bone Homo sapiens (Human) CVCL_0543
CS-1 cells Bone Homo sapiens (Human) CVCL_T023
CSPG cells Bone Homo sapiens (Human) N.A.
JJ012 cells Bone Homo sapiens (Human) CVCL_D605
SNM83 cells Cartilage Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-143 enhances the antitumor activity of shikonin by targeting BAG3 and reducing its expression in human glioblastoma stem cell. ErbB2. miR-125 was downregulated in chondrosarcoma cells and doxorubicin resistant cells. Overexpression of miR-125 enhanced the sensitivity of both parental and doxorubicin resistant cells to doxorubicin through direct targeting on the ErbB2-mediated upregulation of glycolysis in chondrosarcoma cells. Moreover, restoration of the expression of ErbB2 and glucose metabolic enzymes in miR-125 pretransfected cells recovered the susceptibility to doxorubicin.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [7]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Epirubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Inhibition hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT20 cells Breast Homo sapiens (Human) CVCL_0178
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Trypan blue dye exclusion assay
Mechanism Description E2F3, and in some settings E2F1, induce apoptosis through p53-dependent or -independent pathways, Overexpression of miR-125b in MCF-7 cells significantly down-regulated E2F3 protein level, overexpression of miR-125b caused a marked inhibition of anticancer drug activity and increased resistance in breast cancer cells in vitro.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [11]
Resistant Disease Ewing sarcoma [ICD-11: 2B52.0]
Resistant Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR125b-p53/BAKT signaling pathway Activation hsa05206
In Vitro Model RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
VH-64 cells Bones Homo sapiens (Human) CVCL_9672
WE-68 cells Bones Homo sapiens (Human) CVCL_9717
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-glo luminescent cell viability assay
Mechanism Description miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.
Disease Class: Primitive neuroectodermal tumor [ICD-11: 2A00.08] [11]
Resistant Disease Primitive neuroectodermal tumor [ICD-11: 2A00.08]
Resistant Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR125b-p53/BAKT signaling pathway Activation hsa05206
In Vitro Model RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
VH-64 cells Bones Homo sapiens (Human) CVCL_9672
WE-68 cells Bones Homo sapiens (Human) CVCL_9717
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-glo luminescent cell viability assay
Mechanism Description miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [7], [8]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Inhibition hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT20 cells Breast Homo sapiens (Human) CVCL_0178
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Sphere formation assay
Mechanism Description E2F3, and in some settings E2F1, induce apoptosis through p53-dependent or -independent pathways, Overexpression of miR-125b in MCF-7 cells significantly down-regulated E2F3 protein level, overexpression of miR-125b caused a marked inhibition of anticancer drug activity and increased resistance in breast cancer cells in vitro. And elevated miR-125b expression in chemoresistant cancer cells were due to high percentage of SP cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [15]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell autophagy Activation hsa04140
Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC/PI staining assay
Mechanism Description CXCL12/CXCR4 axis induced miR125b promotes invasion and confers 5-fluorouracil resistance through enhancing autophagy in colorectal cancer There was a negative correlation of the expression of miR125b with APC mRNA in paired human colorectal tissue specimens. The upregulation of miR125b activated the Wnt/beta-catenin signaling by targeting APC gene and contributed to 5-FU resistance through enhancing cell autophagy.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [16]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
THLE-2 cells Liver Homo sapiens (Human) CVCL_3803
THLE-3 cells Liver Homo sapiens (Human) CVCL_3804
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Compared with 5-FU-sensitive cells, 5-FU-resistant cells exhibited reduced expression levels of miR-125b, and transfection of pre-miR-125b into liver cancer cells resulted in an increased sensitivity of 5-FU-resistant cells to 5-FU. Since drug resistance is a phenotype of malignant cancer cells, the finding that miR-125b expression levels are negatively correlated with 5-FU resistance in HCC cells is consistent with the reported functions of miR-125b. In addition, 5-FU-resistant cells exhibited higher glucose metabolic activity than 5-FU-sensitive cells, and miR-125 was identified to downregulate glucose metabolism by directly targeting Hk II. These results identified miR-125b as a tumor suppressor-like microRNA, which has great potential as a diagnostic and prognostic biomarker.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [17]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
BT474 cells Breast Homo sapiens (Human) CVCL_0179
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Celltiter 96 aqueous one solution cell proliferation assay
Mechanism Description miR-125b was up-regulated in Taxol-resistant cells, causing a marked inhibition of Taxol-induced cytotoxicity and apoptosis and a subsequent increase in the resistance to Taxol in cancer cells. The pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) is a direct target of miR-125b. Down-regulation of Bak1 suppressed Taxol-induced apoptosis and led to an increased resistance to Taxol.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [18]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model BALB/C nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-125a/b significantly inhibited ALDH1A3 and Mcl1 expression, reduced cell survival, and increased cell apoptosis in HT29-taxol cells. Chemoresistance to paclitaxel is initiated by the downregulation of miR-125a/b expression, which subsequently upregulates ALDH1A3 and Mcl1 expression to promote survival of CSCs.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [19]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-125b was significantly downregulated in A549-PR and H460-PR cells. Notably, ectopic expression of miR-125b led to the reversal of EMT phenotype. Moreover, we found that miR-125b governed PR-induced EMT partly due to down-regulation of its target Sema4C. More importantly, overexpression of miR-125b or depletion of Sema4C sensitized PR cells to paclitaxel. Furthermore, stable overexpression miR-125b in A549-PR cells inhibited tumor xenograft growth in immunodeficient mice. Our study implied that up-regulation of miR-125b could be a novel approach to reverse chemotherapy resistance in lung cancers.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [20]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
NF-kappaB signaling pathway Inhibition hsa04064
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN-18 cells Brain Homo sapiens (Human) CVCL_0392
T98G cells Brain Homo sapiens (Human) CVCL_0556
U87-MG cells Brain Homo sapiens (Human) CVCL_0022
HS683 cells Brain Homo sapiens (Human) CVCL_0844
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Promega assay
Mechanism Description A novel mechanism independent of TP53 and MGMT by which oncogenic miR-125b confers TMZ resistance by targeting TNFAIP3 and NkIRAS2. GBM cells overexpressing miR-125b showed increased NF-kB activity and upregulation of anti-apoptotic and cell cycle genes. This was significantly associated with resistance of GBM cells to TNFalpha- and TNF-related inducing ligand-induced apoptosis as well as resistance to TMZ. Conversely, overexpression of anti-miR-125b resulted in cell cycle arrest, increased apoptosis and increased sensitivity to TMZ, indicating that endogenous miR-125b is sufficient to control these processes. GBM cells overexpressing TNFAIP3 and NkIRAS2 were refractory to miR-125b-induced apoptosis resistance as well as TMZ resistance, indicating that both genes are relevant targets of miR-125b.
Disease Class: Glioblastoma [ICD-11: 2A00.02] [21]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
In Vitro Model GSCs cells Brain Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
PCR
Experiment for
Drug Resistance
Transwell invasion assay
Mechanism Description Inhibition of miR-125b expression may enhance sensitivity of GSCs to temozolomide by targeting PIAS3 on cell invasion.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [22]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell viability Inhibition hsa05200
miR125b/HER2/Snail1 signaling pathway Regulation N.A.
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Wound-healing assay; Transwell assay
Mechanism Description TINCR, which is transcriptionally activated by H3k27 acetylation, upregulates HER-2 expression by downregulating miR-125b and TINCR promotes trastuzumab resistance-induced EMT by directly targeting Snail-1.
Vemurafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [23]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Vemurafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model PLX4032-resistant cells Skin Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description CCL2 and miR-125b, miR-34a and miR-100 are potential targets for overcoming the miR-34a and miR-100 are potential targets for overcoming the resistance to BRAFi in melanoma.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [24]
Resistant Disease Acute lymphocytic leukemia [ICD-11: 2B33.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model ETV6-RUNX1-positive Reh cells Blood Homo sapiens (Human) CVCL_1650
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL).
Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [11]
Resistant Disease Ewing sarcoma [ICD-11: 2B52.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR125b-p53/BAKT signaling pathway Activation hsa05206
In Vitro Model RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
VH-64 cells Bones Homo sapiens (Human) CVCL_9672
WE-68 cells Bones Homo sapiens (Human) CVCL_9717
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-glo luminescent cell viability assay
Mechanism Description miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.
Disease Class: Primitive neuroectodermal tumor [ICD-11: 2A00.08] [11]
Resistant Disease Primitive neuroectodermal tumor [ICD-11: 2A00.08]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR125b-p53/BAKT signaling pathway Activation hsa05206
In Vitro Model RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
VH-64 cells Bones Homo sapiens (Human) CVCL_9672
WE-68 cells Bones Homo sapiens (Human) CVCL_9717
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-glo luminescent cell viability assay
Mechanism Description miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.
References
Ref 1 lncRNA MIR100HG-derived miR-100 and miR-125b mediate cetuximab resistance via Wnt/Beta-catenin signaling. Nat Med. 2017 Nov;23(11):1331-1341. doi: 10.1038/nm.4424. Epub 2017 Oct 16.
Ref 2 Has miR 125a and 125b are induced by treatment with cisplatin in nasopharyngeal carcinoma and inhibit apoptosis in a p53 dependent manner by targeting p53 mRNA. Mol Med Rep. 2015 Sep;12(3):3569-3574. doi: 10.3892/mmr.2015.3863. Epub 2015 May 27.
Ref 3 miR-125b confers resistance of ovarian cancer cells to cisplatin by targeting pro-apoptotic Bcl-2 antagonist killer 1. J Huazhong Univ Sci Technolog Med Sci. 2011 Aug;31(4):543. doi: 10.1007/s11596-011-0487-z. Epub 2011 Aug 7.
Ref 4 microRNA-125b reverses the multidrug resistance of nasopharyngeal carcinoma cells via targeting of Bcl-2. Mol Med Rep. 2017 Apr;15(4):2223-2228. doi: 10.3892/mmr.2017.6233. Epub 2017 Feb 22.
Ref 5 The functional mechanism of miR-125b in gastric cancer and its effect on the chemosensitivity of cisplatin. Oncotarget. 2017 Dec 14;9(2):2105-2119. doi: 10.18632/oncotarget.23249. eCollection 2018 Jan 5.
Ref 6 MiR-125b Functions as a Tumor Suppressor and Enhances Chemosensitivity to Cisplatin in Osteosarcoma. Technol Cancer Res Treat. 2016 Dec;15(6):NP105-NP112. doi: 10.1177/1533034615618849. Epub 2016 Jan 6.
Ref 7 Circulating MiR-125b as a marker predicting chemoresistance in breast cancer. PLoS One. 2012;7(4):e34210. doi: 10.1371/journal.pone.0034210. Epub 2012 Apr 16.
Ref 8 miR-125b regulates side population in breast cancer and confers a chemoresistant phenotype. J Cell Biochem. 2013 Oct;114(10):2248-57. doi: 10.1002/jcb.24574.
Ref 9 microRNA 125b promotes leukemia cell resistance to daunorubicin by inhibiting apoptosis. Mol Med Rep. 2014 May;9(5):1909-16. doi: 10.3892/mmr.2014.2011. Epub 2014 Mar 6.
Ref 10 miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
Ref 11 miR-125b develops chemoresistance in Ewing sarcoma/primitive neuroectodermal tumor. Cancer Cell Int. 2013 Mar 4;13(1):21. doi: 10.1186/1475-2867-13-21.
Ref 12 Upregulation of microRNA-125b contributes to leukemogenesis and increases drug resistance in pediatric acute promyelocytic leukemia. Mol Cancer. 2011 Sep 1;10:108. doi: 10.1186/1476-4598-10-108.
Ref 13 miR-125b regulates the drug-resistance of breast cancer cells to doxorubicin by targeting HAX-1. Oncol Lett. 2018 Feb;15(2):1621-1629. doi: 10.3892/ol.2017.7476. Epub 2017 Nov 23.
Ref 14 miR-125b acts as a tumor suppressor in chondrosarcoma cells by the sensitization to doxorubicin through direct targeting the ErbB2-regulated glucose metabolism. Drug Des Devel Ther. 2016 Feb 24;10:571-83. doi: 10.2147/DDDT.S90530. eCollection 2016.
Ref 15 CXCL12/CXCR4 axis induced miR-125b promotes invasion and confers 5-fluorouracil resistance through enhancing autophagy in colorectal cancer. Sci Rep. 2017 Feb 8;7:42226. doi: 10.1038/srep42226.
Ref 16 Overexpression of microRNA-125b sensitizes human hepatocellular carcinoma cells to 5-fluorouracil through inhibition of glycolysis by targeting hexokinase II. Mol Med Rep. 2014 Aug;10(2):995-1002. doi: 10.3892/mmr.2014.2271. Epub 2014 May 26.
Ref 17 MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
Ref 18 MiR-125a/b regulates the activation of cancer stem cells in paclitaxel-resistant colon cancer. Cancer Invest. 2013 Jan;31(1):17-23. doi: 10.3109/07357907.2012.743557.
Ref 19 Up-regulation of miR-125b reverses epithelial-mesenchymal transition in paclitaxel-resistant lung cancer cells. Biol Chem. 2015 Aug 20:/j/bchm.just-accepted/hsz-2015-0153/hsz-2015-0153.xml. doi: 10.1515/hsz-2015-0153. Online ahead of print.
Ref 20 miR-125b controls apoptosis and temozolomide resistance by targeting TNFAIP3 and NKIRAS2 in glioblastomas. Cell Death Dis. 2014 Jun 5;5(6):e1279. doi: 10.1038/cddis.2014.245.
Ref 21 miR-125b inhibitor may enhance the invasion-prevention activity of temozolomide in glioblastoma stem cells by targeting PIAS3. BioDrugs. 2014 Feb;28(1):41-54. doi: 10.1007/s40259-013-0053-2.
Ref 22 Activation of LncRNA TINCR by H3K27 acetylation promotes Trastuzumab resistance and epithelial-mesenchymal transition by targeting MicroRNA-125b in breast Cancer. Mol Cancer. 2019 Jan 8;18(1):3. doi: 10.1186/s12943-018-0931-9.
Ref 23 Overcoming melanoma resistance to vemurafenib by targeting CCL2-induced miR-34a, miR-100 and miR-125b. Oncotarget. 2016 Jan 26;7(4):4428-41. doi: 10.18632/oncotarget.6599.
Ref 24 MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leuk Res. 2013 Oct;37(10):1315-21. doi: 10.1016/j.leukres.2013.06.027. Epub 2013 Jul 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.