General Information of the Molecule (ID: Mol01407)
Name
hsa-mir-200b ,Homo sapiens
Synonyms
microRNA 200b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR200B
Gene ID
406984
Location
chr1:1167104-1167198[+]
Sequence
CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAU
ACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG
    Click to Show/Hide
Ensembl ID
ENSG00000207730
HGNC ID
HGNC:31579
Precursor Accession
MI0000342
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
11 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [1]
Resistant Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Differential expression of the molecule in resistant disease
Classification of Disease Gastric cancer [ICD-11: 2B72]
The Specified Disease Stomach adenocarcinoma
The Studied Tissue Stomach
The Expression Level of Disease Section Compare with the Healthy Individual Tissue
p-value: 3.24E-02
Fold-change: -1.54E+00
Z-score: -3.43E+00
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [3]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.
Disease Class: Endometrial cancer [ICD-11: 2C76.1] [3]
Resistant Disease Endometrial cancer [ICD-11: 2C76.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEC-1A cells Uterus Homo sapiens (Human) CVCL_0293
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.
Disease Class: Lung cancer [ICD-11: 2C25.5] [1]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Tongue cancer [ICD-11: 2B62.0] [4]
Resistant Disease Tongue cancer [ICD-11: 2B62.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation SHH/GLI1 signaling pathway Activation hsa05217
In Vitro Model CAL27 cells Oral Homo sapiens (Human) CVCL_1107
SCC25 cells Oral Homo sapiens (Human) CVCL_1682
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of BMI1 alters cell proliferation, apoptosis and stem cell self-renewal and correlates with the invasion and metastasis of several human cancers. BMI1 overexpression due to reduction of miR-200b and miR-15b may result in chemotherapy-induced EMT in TSCCs via these pathways.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [5]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
HIOSE-80 cells Ovary Homo sapiens (Human) CVCL_E274
OV119 cells Ovary Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-200b- and miR-200c-mediated downregulation of DNMTs may improve chemotherapeutic efficacy by increasing the sensitivity of cancer cells.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [6]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
H69AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-200b was down-regulated in the resistant cells and enforced expression of miR-200b by miRNA mimics increased cell sensitivity. Overexpression of miR-200b led to the downregulation of ZEB2 at protein level. Luciferase reporter gene assay showed that 3'UTR ZEB2 activity was regulated by miR-200b. ZEB2 modulates drug resistance and is regulated by miR-200b. knockdown of ZEB2 increased cell sensitivity through increasing drug-induced cell apoptosis accompanied with S phase arrest. ZEB2 was regulated by miR-200b at protein level.
Cetuximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [2]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation EGFR signaling pathway Regulation N.A.
In Vitro Model 253J BV cells Bladder Homo sapiens (Human) CVCL_7937
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Pulse-labeling cells with [3H]thymidine
Mechanism Description Members of the miR-200 family appear to control the EMT process and sensitivity to EGFR therapy, in bladder cancer cells and that expression of miR-200 is sufficient to restore EGFR dependency, at least in some of the mesenchymal bladder cancer cells. The targets of miR-200 include ERRFI-1, which is a novel regulator of EGFR-independent growth.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [7]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [8]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
HDAC1/4/Sp1/miR200b/E2F3 signaling pathway Inhibition hsa05206
In Vitro Model H1299/DTX cells Lung Homo sapiens (Human) CVCL_0060
SPC-A1/DTX cells Lung Homo sapiens (Human) CVCL_W217
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Histone deacetylase (HDAC) inhibitors could restore the expression of miR-200b and reverse chemoresistant phenotypes of docetaxel-resistant LAD cells. HDAC1/4 repression significantly increased miR-200b expression by upregulating histone-H3 acetylation level at the two miR-200b promoters partially via a Sp1-dependent pathway. Furthermore, silencing of HDAC1/4 suppressed cell proliferation, promoted cell apoptosis, induced G2/M cell cycle arrest and ultimately reversed in vitro and in vivo chemoresistance of docetaxel-resistant LAD cells, at least partially in a miR-200b-dependent manner. HDAC1/4 suppression-induced rescue of miR-200b contributed to downregulation of E2F3, survivin and Aurora-A, and upregulation of cleaved-caspase-3. HDAC1/4 levels in docetaxel-insensitive human LAD tissues, inversely correlated with miR-200b, were upregulated compared with docetaxel-sensitive tissues. Taken together, our findings suggest that the HDAC1/4/Sp1/miR-200b/E2F3 pathway is responsible for chemoresistance of docetaxel-resistant LAD cells.
Disease Class: Prostate cancer [ICD-11: 2C82.0] [9]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Bmi-1 is expressed at a high level in PCa. miR-200b plays a pivotal role in PCa at least in part via downregulation of the oncogene Bmi-1, inhibition of Bmi-1 enhanced the antitumor activity of docetaxel in PCa cells.
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [10]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description E2F3 was generally considered to increase cellular proliferation as a transcriptional activator through the G1/S transition, down-regulation of miR-200b could lead to E2F3 overexpression and in turn contribute to chemoresistance of lung adenocarcinoma cells to docetaxel.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT549 cells Breast Homo sapiens (Human) CVCL_1092
HCC70 cells Breast Homo sapiens (Human) CVCL_1270
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
CAMA-1 cells Breast Homo sapiens (Human) CVCL_1115
MCF-10-2A cells Breast Homo sapiens (Human) CVCL_3743
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Celltiter-blue cell viability assay
Mechanism Description The up-regulation of the miR-200b and miR-200c diminishes EMT by directly targeting the transcriptional repressor ZEB1 leading to up-regulation of E-cadherin. Restoration of E-cadherin expression increases the sensitivity of cancer cells to chemotherapeutic agents. Disruption of ZEB1-histone deacetylase repressor complexes and down-regulation of histone deacetylase, in particular SIRT1, positively affect the p53 apoptotic pathway leading to the increased sensitivity of breast cancer cells to chemotherapy and radiotherapy.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [12]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Hedgehog signaling pathway Inhibition hsa04340
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-200b and let-7c, inhibited the TGF-beta1-mediated resistance of NSCLC cells to erlotinib.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [13]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TGF-Beta/miR200/MIG6 signaling pathway Inhibition hsa05206
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
NCl-H1437 cells Lung Homo sapiens (Human) CVCL_1472
H1703 cells Lung Homo sapiens (Human) CVCL_1490
H23 cells Lung Homo sapiens (Human) CVCL_1547
Calu6 cells Lung Homo sapiens (Human) CVCL_0236
H1838 cells Lung Homo sapiens (Human) CVCL_1499
H1915 cells Lung Homo sapiens (Human) CVCL_1505
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR; RT-PCR
Experiment for
Drug Resistance
Alamar Blue assay
Mechanism Description The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.
Disease Class: Bladder cancer [ICD-11: 2C94.0] [13]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TGF-Beta/miR200/MIG6 signaling pathway Inhibition hsa05206
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
NCl-H1437 cells Lung Homo sapiens (Human) CVCL_1472
H1703 cells Lung Homo sapiens (Human) CVCL_1490
H23 cells Lung Homo sapiens (Human) CVCL_1547
Calu6 cells Lung Homo sapiens (Human) CVCL_0236
H1838 cells Lung Homo sapiens (Human) CVCL_1499
H1915 cells Lung Homo sapiens (Human) CVCL_1505
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR; RT-PCR
Experiment for
Drug Resistance
Alamar Blue assay
Mechanism Description The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [14]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
In Vitro Model QBC939 cells Bile duct Homo sapiens (Human) CVCL_6942
TFk-1 cells Bile duct Homo sapiens (Human) CVCL_2214
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
WST cell counting kit-8
Mechanism Description miR-200b/c influenced the tumourigenesis of cholangiocarcinoma cells including their tumour-initiating capacity, sphere formation, and drug resistance (like fluorouracil). We further found that miR-200b/c regulated migration and invasion capacities by directly targeting rho-kinase 2 and regulated tumorigenic properties by directly targeting SUZ12 (a subunit of a polycomb repressor complex).
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic carcinoma [ICD-11: 2C10.2] [15]
Sensitive Disease Pancreatic carcinoma [ICD-11: 2C10.2]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell metastasis Inhibition hsa05205
Cell proliferation Inhibition hsa05200
Chemosensitivity Activation hsa05207
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Colorimetric methylene blue assay; Flow cytometry assay
Mechanism Description Forced expression of miR-200b induces CDH1 expression and promotes gemcitabine sensitivity in Capan-2 and Panc-1 cells.
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [16]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
KMCH-1 cells Gallbladder Homo sapiens (Human) CVCL_7970
Mz-ChA-1 cells Gallbladder Homo sapiens (Human) CVCL_6932
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
Northern blotting analysis
Experiment for
Drug Resistance
Celltiter 96 aqueous one solution cell proliferation assay
Mechanism Description PTPN12 can bind and dephosphorylate the product ofoncogenes such as c-Abl or Src and inactivate the Raspathway. Thus, deregulation of PTPN12 expressionmay contribute to tumor cell survival and oncogenesis. In cells transfected with anti-miR-200b, PTPN12 ex-pression was increased to 132.2%+/-7.2% of controlafter 48 hours and 147.3%+/-12.8% of control after 72hours. Moreover, inhibition of miR-200b significantlyreduced the tyrosine phosphorylation of a downstreamtarget Src, a key mediator of tumor cell proliferation anddifferentiation.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [17]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description Re-expression of miR-200 in gemcitabine-resistant cells showed partial reversal of EMT characteristics as documented by increased expression of E-cadherin and decreased expression of vimentin, ZEB1, and slug. These results suggest that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin and that the re-expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-epithelial transition (MET). re-expression of miR-200 by transfection studies or treatment of gemcitabine-resistant cells with either DIM or isoflavone resulted in the down-regulation of ZEB1, slug, and vimentin, which was consistent with morphological reversal of EMT phenotype leading to epithelial morphology.
Intedanib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [18]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Intedanib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
PC9 cells Lung Homo sapiens (Human) CVCL_B260
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
PC-14 cells Lung Homo sapiens (Human) CVCL_1640
EBC-1 cells Lung Homo sapiens (Human) CVCL_2891
LC-1/sq cells Lung Homo sapiens (Human) CVCL_3008
LC-2/ad cells Lung Homo sapiens (Human) CVCL_1373
Lk-2 cells Lung Homo sapiens (Human) CVCL_1377
NCI-HCC827 cells Lung Homo sapiens (Human) CVCL_2063
PC-1 cells Pancreas Homo sapiens (Human) CVCL_S978
PC-10 cells Lung Homo sapiens (Human) CVCL_7088
QG56 cells Lung Homo sapiens (Human) CVCL_6943
RERF-LCkJ cells Lung Homo sapiens (Human) CVCL_1654
SQ5 cells Lung Homo sapiens (Human) CVCL_8273
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-200b and miR-141 associated with epithelial-mesenchymal transition (EMT) are predictive biomarkers and therapeutic targets of nintedanib in NSCLC cells. nintedanib inhibited EMT and reversed the resistance to EGFR-TkI with TGF-beta-induced EMT through miR-200 family induction in NSCLC cells. low expression of miR-200b and miR-141, resulting in high level of ZEB1 and low level of E-cadherin, was associated with the resistance to nintedanib in NSCLC cells.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [19]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [1]
Resistant Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Disease Class: Lung cancer [ICD-11: 2C25.5] [1]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Vincristine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Fas/FasL signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.
Curcumin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [20]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Curcumin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HepJ5 cells Liver Homo sapiens (Human) CVCL_RW48
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The overexpression ofmiR-200a/b in HepJ5 cells conferred enhanced resistance tocurcumin treatment compared with the control cells.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Celastrol
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [19]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Celastrol
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
Disease- and Tissue-specific Abundances of This Molecule
ICD Disease Classification 02
Click to Show/Hide the Resistance Disease of This Class
Gastric cancer [ICD-11: 2B72]
Click to Show/Hide
Differential expression of molecule in resistant diseases
The Studied Tissue Stomach
The Specified Disease Stomach adenocarcinoma
The Expression Level of Disease Section Compare with the Healthy Individual Tissue p-value: 4.93E-04; Fold-change: 1.65E-01
Molecule expression in the diseased tissue of patients
Molecule expression in the normal tissue of healthy individuals
Disease-specific Molecule Abundances Click to View the Clearer Original Diagram
References
Ref 1 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31. doi: 10.1007/s00280-011-1752-3. Epub 2011 Oct 13.
Ref 2 miR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy. Clin Cancer Res. 2009 Aug 15;15(16):5060-72. doi: 10.1158/1078-0432.CCR-08-2245. Epub 2009 Aug 11.
Ref 3 A miR-200b/200c/429-binding site polymorphism in the 3' untranslated region of the AP-2Alpha gene is associated with cisplatin resistance. PLoS One. 2011;6(12):e29043. doi: 10.1371/journal.pone.0029043. Epub 2011 Dec 14.
Ref 4 MiR-200b and miR-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1. Oncogene. 2012 Jan 26;31(4):432-45. doi: 10.1038/onc.2011.263. Epub 2011 Jul 4.
Ref 5 miR-200b and miR-200c co-contribute to the cisplatin sensitivity of ovarian cancer cells by targeting DNA methyltransferases. Oncol Lett. 2019 Feb;17(2):1453-1460. doi: 10.3892/ol.2018.9745. Epub 2018 Nov 22.
Ref 6 Zinc finger E-box-binding homeobox 2 (ZEB2) regulated by miR-200b contributes to multi-drug resistance of small cell lung cancer. Exp Mol Pathol. 2014 Jun;96(3):438-44. doi: 10.1016/j.yexmp.2014.04.008. Epub 2014 Apr 22.
Ref 7 Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
Ref 8 HDAC 1/4-mediated silencing of microRNA-200b promotes chemoresistance in human lung adenocarcinoma cells. Oncotarget. 2014 May 30;5(10):3333-49. doi: 10.18632/oncotarget.1948.
Ref 9 miR-200b suppresses cell proliferation, migration and enhances chemosensitivity in prostate cancer by regulating Bmi-1. Oncol Rep. 2014 Feb;31(2):910-8. doi: 10.3892/or.2013.2897. Epub 2013 Dec 5.
Ref 10 MicroRNA-200b reverses chemoresistance of docetaxel-resistant human lung adenocarcinoma cells by targeting E2F3. Cancer. 2012 Jul 1;118(13):3365-76. doi: 10.1002/cncr.26560. Epub 2011 Dec 2.
Ref 11 E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cells. Int J Cancer. 2010 Jun 1;126(11):2575-83. doi: 10.1002/ijc.24972.
Ref 12 Inhibition of Hedgehog signaling sensitizes NSCLC cells to standard therapies through modulation of EMT-regulating miRNAs. J Hematol Oncol. 2013 Oct 7;6(1):77. doi: 10.1186/1756-8722-6-77.
Ref 13 The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
Ref 14 Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104. doi: 10.1038/bjc.2013.655. Epub 2013 Oct 29.
Ref 15 MicroRNA-200b and -301 are associated with gemcitabine response as biomarkers in pancreatic carcinoma cells. Int J Oncol. 2019 Mar;54(3):991-1000. doi: 10.3892/ijo.2019.4676. Epub 2019 Jan 7.
Ref 16 Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006 Jun;130(7):2113-29. doi: 10.1053/j.gastro.2006.02.057.
Ref 17 Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.
Ref 18 miR-200/ZEB axis regulates sensitivity to nintedanib in non-small cell lung cancer cells. Int J Oncol. 2016 Mar;48(3):937-44. doi: 10.3892/ijo.2016.3331. Epub 2016 Jan 11.
Ref 19 miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
Ref 20 MicroRNA-200a/b influenced the therapeutic effects of curcumin in hepatocellular carcinoma (HCC) cells. Tumour Biol. 2013 Oct;34(5):3209-18. doi: 10.1007/s13277-013-0891-z. Epub 2013 Jun 13.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.