Molecule Information
General Information of the Molecule (ID: Mol01404)
Name |
hsa-mir-222
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 222
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR222
|
||||
Gene ID | |||||
Location |
chrX:45747015-45747124[-]
|
||||
Sequence |
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCG
UAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Oral squamous cell carcinoma | [1] | |||
Sensitive Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | UM1 cells | Tongue | Homo sapiens (Human) | CVCL_VH00 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Antisense (As)-miR-222 inhibits the expression of miR-222. In contrast, PUMA was dramaticallyup-regulated. IC50 values were significantly decreased in cells treated with As-miR-222 combined with CDDP, to a greater extent than in cells treated with CDDP alone. Furthermore, As-miR-222 (+) apoptosis and inhibited the invasiveness of UM1 cells. Analysis of the above data suggested that, in UM1 cells, there might be a regulatory loop between miR-222 and PUMA, and that miR-222 inhibition increased the chemosensitivity to CDDP. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [2] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | PTEN plays major roles in suppressing cancer and embryonic development, cell migration and apoptosis, miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [3] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Bim signaling pathway | Activation | hsa05206 | |
Cell apoptosis | Activation | hsa04210 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | microRNA-222 promotes drug resistance to doxorubicin in breast cancer via regulation of miR-222/bim pathway. | |||
Disease Class: Breast cancer | [4], [5] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PTEN/AKT/FOXO1 signaling pathway | Inhibition | hsa05235 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
MCF-7/S cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin-V-APC apoptosis assay; Flow cytometry assay | |||
Mechanism Description | miR222 promotes drug-resistance of breast cancer cells to adriamycin via modulation of PTEN/Akt/FOXO1 pathway, inhibition of miR222 resulted in increased PTEN expression and decreased p-Akt expression. The expression of miR222 is negatively correlated with FOXO1 expression in breast cancer cells. Inhibition of miR222 could reverse the ADR-resistance and improve the prognosis of breast cancer patients. | |||
Disease Class: Breast cancer | [6] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-222 induced Adr-resistance at least in part via suppressing p27kip1 expression and altering its subcellular localization, and miR-222 inhibitors could reverse Adr-resistance of breast cancer cells. | |||
Disease Class: Breast cancer | [2] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | PTEN plays major roles in suppressing cancer and embryonic development, cell migration and apoptosis, miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [7] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | ADAM-17 (a desintegrin and metalloproteases 17) is a novel multidrug resistance (MDR) mechanism in multidrug-resistant colorectal carcinoma (CRC). The presence of miR-222 was consistently inversely proportionate to the expression levels of ADAM-17. The loss of miR-222 in the HCT116/L-OHP and HCT-8/VCR MDR cell lines contributed to the overexpression of ADAM-17 and sensitized the HCT116/L-OHP and HCT-8/VCR MDR cells to some anticancer drugs. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [7] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | ADAM-17 (a desintegrin and metalloproteases 17) is a novel multidrug resistance (MDR) mechanism in multidrug-resistant colorectal carcinoma (CRC). The presence of miR-222 was consistently inversely proportionate to the expression levels of ADAM-17. The loss of miR-222 in the HCT116/L-OHP and HCT-8/VCR MDR cell lines contributed to the overexpression of ADAM-17 and sensitized the HCT116/L-OHP and HCT-8/VCR MDR cells to some anticancer drugs. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [8] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Sorafenib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell proliferation | Activation | hsa05200 | ||
PI3K/AKT signaling pathway | Regulation | hsa04151 | ||
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
HL-7702 cells | Liver | Homo sapiens (Human) | CVCL_6926 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR 222 facilitate sorafenib resistance and enhance tumorigenicity in hepatocellular carcinoma. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [9] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Ectopic expression of miR-221/222 rendered the parental MCF-7 cells resistant to tamoxifen. The protein level of the cell cycle inhibitor p27kip1, a known target of miR-221/222, was reduced by 50% in OHTR cells and by 28-50% in miR-221/222-overexpressing MCF-7 cells. Furthermore, overexpression of p27kip1 in the resistant OHTR cells caused enhanced cell death when exposed to tamoxifen. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [10] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-8 assay | |||
Mechanism Description | Transfection of AS-miR-221 and AS-miR-222 dramatically inhibited expression of miR-221 and miR-222, respectively, in both MCF-7 and MDA-MB-231 cells (P<0.05-0.01). Down-regulation of miR-221/222 significantly increased the expression of TIMP3 compared with controls (P<0.05-0.01). The viability of estrogen receptor (ER)-positive MCF-7 cells transfected with AS-miR-221 or/and AS-miR-222 was significantly reduced by tamoxifen (P<0.05-0.01). Suppression of miRNA-221/222 increases the sensitivity of ER-positive MCF-7 breast cancer cells to tamoxifen. This effect is mediated through upregulation of TIMP3. These findings suggest that upregulation of TIMP3 via inhibition of miRNA-221/222 could be a promising therapeutic approach for breast cancer. | |||
Disease Class: Breast cancer | [11] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
MDA-MB-453 cells | Breast | Homo sapiens (Human) | CVCL_0418 | |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
MCF10A cells | Breast | Homo sapiens (Human) | CVCL_0598 | |
MDA-MB-157 cells | Breast | Homo sapiens (Human) | CVCL_0618 | |
MDA-MB-361 cells | Breast | Homo sapiens (Human) | CVCL_0620 | |
MDA-MB-435s cells | Breast | Homo sapiens (Human) | CVCL_0622 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-221 and miR-222 are frequently up-regulated in ERalpha-negative breast cancer cell lines and primary tumors. The elevated level of miR-221 and miR-222 is responsible for a subset of ERalpha-negative breast tumors that express ERalpha mRNA. Furthermore, overexpression of miR-221 and miR-222 contributes to tamoxifen resistance through negative regulation of ERalpha, whereas knockdown of miR-221 and/or miR-222 restores ERalpha expression and tamoxifen sensitivity. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [7] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | ADAM-17 (a desintegrin and metalloproteases 17) is a novel multidrug resistance (MDR) mechanism in multidrug-resistant colorectal carcinoma (CRC). The presence of miR-222 was consistently inversely proportionate to the expression levels of ADAM-17. The loss of miR-222 in the HCT116/L-OHP and HCT-8/VCR MDR cell lines contributed to the overexpression of ADAM-17 and sensitized the HCT116/L-OHP and HCT-8/VCR MDR cells to some anticancer drugs. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [12] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | TRAIL | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
TRAIL signaling pathway | Inhibition | hsa04210 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
Calu1 cells | Lung | Homo sapiens (Human) | CVCL_0608 | |
Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of kit and p27kip1 mRNAs, but interfere with TRAIL signaling mainly through p27kip1. miR-221 and -222 modulate TRAIL sensitivity in lung cancer cells mainly by modulating p27kip1 expression and TRAIL-induced caspase machinery. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.