Molecule Information

General Information of the Molecule (ID: Mol01403)

• Name: hsa-mir-221 ,Homo sapiens
• Synonyms: microRNA 221
• Molecule Type: Precursor miRNA
• Gene Name: MIR221
• Gene ID: 407006
• Location: chrX:45746157-45746266[-]
• Sequence:
  UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUCGUUAGG
  CAACAGCUACAUUGUCUGCUGGGUUUCAGGCUACCUGGAAACAUGUUCUC
• Ensembl ID: ENSG00000207870
• HGNC ID: HGNC:31601
• Precursor Accession: MI0000298

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 16 drug(s) in total

Carmustine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Carmustine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3-k/PTEN/AKT signaling axis; Activation; hsa04151
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-221 regulated cell proliferation and BCNU resistance in glioma cells. Overexpression of miR-221 led to cell survival and BCNU resistance and reduced cell apoptosis induced by BCNU, whereas knockdown of miR-221 inhibited cell proliferation and prompted BCNU sensitivity and cell apoptosis. Further investigation revealed that miR-221 down-regulated PTEN and activated Akt, which resulted in cell survival and BCNU resistance. Overexpression of PTEN lacking 3'UTR or PI3-k/Akt specific inhibitor wortmannin attenuated miR-221-mediated BCNU resistance and prompted cell apoptosis. We propose that miR-221 regulated cell proliferation and BCNU resistance in glioma cells by targeting PI3-k/PTEN/Akt signaling axis.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell senescence; Inhibition; hsa04218
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; SA-beta-gal assay
• Mechanism Description: Suppression of miR-221 could lead to increase of PTEN expression level and enhance the CDDP chemosensitivity.

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [3]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: SOSP-9607 cells; Bones; Homo sapiens (Human); CVCL_4V80
• In Vitro Model: SOSP-9901 cells; Bones; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-221 induce cell survival and cisplatin resistance in human osteosarcoma at least partly through targeting the PI3k/PTEN/Akt pathway.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Patient treatment and assessment assay
• Mechanism Description: The expression level of miR-221 was significantly associated with hormone receptor (HR) status. Patients with higher plasma miR-221 levels tended to be HR-negative. plasma miR-221 may be a predictive biomarker for sensitivity to NAC in breast cancer patients.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [5]

• Sensitive Disease: Oral squamous cell carcinoma [ICD-11: 2B6E.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SCC4 cells; Tongue; Homo sapiens (Human); CVCL_1684
• In Vitro Model: SCC9 cells; Tongue; Homo sapiens (Human); CVCL_1685
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Annexin V-fluorescein isothiocyanate (FITC)/Hoechst double staining; MTT assay
• Mechanism Description: OSCC cells are resistant to doxorubicin through upregulation of miR221, which in turn downregulates TIMP3.

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [6]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-221 can activate the p53/mdm2 axis by inhibiting MDM2 and, in turn, p53 activation contributes to miR-221 enhanced expression. Moreover, by modulating the p53 axis, miR-221 impacts cell-cycle progression and apoptotic response to doxorubicin in hepatocellular carcinoma-derived cell lines.

Fludarabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic lymphocytic leukemia [ICD-11: 2A82.0] [7]

• Resistant Disease: Chronic lymphocytic leukemia [ICD-11: 2A82.0]
• Resistant Drug: Fludarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: High levels of miR-181a and miR-221 also point to cell cycle progression as both miRNAs repress CDkN1B (p27) expression in hematologic diseases and p27 was also found down-regulated in resistant cells.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [8]

• Resistant Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin/EMT signaling pathway; Activation; hsa04310
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: OE33 cellss; Esophagus; Homo sapiens (Human); CVCL_0471
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) staining assay
• Mechanism Description: miR-221 mediates chemoresistance of esophageal adenocarcinoma by direct targeting and reducing of Dkk2 expression.

Fulvestrant

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Fulvestrant
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/beta-catenin signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: TGF-betasignalling pathway; Regulation; N.A.
• Cell Pathway Regulation: p53 signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Notch signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: ErbB signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Jak-STAT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Focal Adhesion pathway; Regulation; N.A.
• Cell Pathway Regulation: PI3K/AKT signalling pathway; Regulation; N.A.
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenicity assays; MTT assay
• Mechanism Description: Activation of beta-catenin by miR-221/222 contributed to estrogen-independent growth and fulvestrant resistance, whereas TGF-beta-mediated growth inhibition was repressed by the two miRNAs

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [10]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-221 may inhibit apoptosis by down regulating the expression of Apaf-1, so as to induce the resistance of PC-9 cells to gefitinib.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [11]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR221/SOCS3 signaling pathway; Regulation; N.A.
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-221 overexpression can promote proliferation, migration, emt, chemotherapy resistance, and stem cell-like properties in panc-1 cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [12]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HuCCT1 cells; Bile duct; Homo sapiens (Human); CVCL_0324
• In Vitro Model: HuH28 cells; Bile duct; Homo sapiens (Human); CVCL_2955
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-221 was downregulated in Gem-resistant HuH28 cells, and that it acted as a potent enhancer of Gem sensitivity, at least partly, by downregulating PIk3R1 expression.

Melphalan

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [ICD-11: 2A83.0] [13]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Melphalan
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: NCI-H929 cells; Bone marrow; Homo sapiens (Human); CVCL_1600
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: RPMI-8226/BTZ cells; Pancreas; Homo sapiens (Human); CVCL_XK17
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-221/222 expression inversely correlated with melphalan-sensitivity of MM cells. Inhibition of miR-221/222 overcame melphalan-resistance and triggered apoptosis of MM cells in vitro, in the presence or absence of human bone marrow stromal cells. Decreased MM cell growth induced by inhibition of miR-221/222 plus melphalan was associated with a marked upregulation of pro-apoptotic BBC3/PUMA protein, a miR-221/222 target, as well as with modulation of drug influx-efflux transporters SLC7A5/LAT1 and the ATP-binding cassette (ABC) transporter ABCC1/MRP1. Finally, in vivo treatment of SCID/NOD mice bearing human melphalan-refractory MM xenografts with systemic LNA-i-miR-221 plus melphalan overcame drug-resistance, evidenced by growth inhibition with significant antitumor effects together with modulation of PUMA and ABCC1 in tumors retrieved from treated mice.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [14]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Colorectal cancer cells; Colon; Homo sapiens (Human); N.A.
• In Vivo Model: Colorectal cancer patients; Homo sapiens
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: In line with these findings, we conclude that the increased baseline exosomal expression of miR-92a-3p and miR-221-3p seems to predict a lack of response to chemotherapy and lower OS. However, further prospective studies on more patients are needed before drawing practice-changing conclusions.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [15]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot
• Experiment for Drug Resistance: Apoptosis Assay; Cell Viability Assay
• Mechanism Description: Taken together, our data strongly support a central role for miR-125b in conferring Taxol resistance through the suppression of Bak1 expression.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [16]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU398 cells; Liver; Homo sapiens (Human); CVCL_0077
• In Vitro Model: SNU449 cells; Liver; Homo sapiens (Human); CVCL_0454
• In Vitro Model: SNU475 cells; Liver; Homo sapiens (Human); CVCL_0497
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Caspase 3/7 activity assay; Cell-titer-Glo assay; Flow cytometry assay
• Mechanism Description: In hepatocellular carcinoma miR221 modulates sorafenib resistance through inhibition of caspase-3-mediated apoptosis.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [17]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ectopic expression of miR-221/222 rendered the parental MCF-7 cells resistant to tamoxifen. The protein level of the cell cycle inhibitor p27kip1, a known target of miR-221/222, was reduced by 50% in OHTR cells and by 28-50% in miR-221/222-overexpressing MCF-7 cells. Furthermore, overexpression of p27kip1 in the resistant OHTR cells caused enhanced cell death when exposed to tamoxifen.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [18]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-8 assay
• Mechanism Description: Transfection of AS-miR-221 and AS-miR-222 dramatically inhibited expression of miR-221 and miR-222, respectively, in both MCF-7 and MDA-MB-231 cells (P<0.05-0.01). Down-regulation of miR-221/222 significantly increased the expression of TIMP3 compared with controls (P<0.05-0.01). The viability of estrogen receptor (ER)-positive MCF-7 cells transfected with AS-miR-221 or/and AS-miR-222 was significantly reduced by tamoxifen (P<0.05-0.01). Suppression of miRNA-221/222 increases the sensitivity of ER-positive MCF-7 breast cancer cells to tamoxifen. This effect is mediated through upregulation of TIMP3. These findings suggest that upregulation of TIMP3 via inhibition of miRNA-221/222 could be a promising therapeutic approach for breast cancer.

Disease Class: Breast cancer [ICD-11: 2C60.3] [19]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-MB-157 cells; Breast; Homo sapiens (Human); CVCL_0618
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: MDA-MB-435s cells; Breast; Homo sapiens (Human); CVCL_0622
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-221 and miR-222 are frequently up-regulated in ERalpha-negative breast cancer cell lines and primary tumors. The elevated level of miR-221 and miR-222 is responsible for a subset of ERalpha-negative breast tumors that express ERalpha mRNA. Furthermore, overexpression of miR-221 and miR-222 contributes to tamoxifen resistance through negative regulation of ERalpha, whereas knockdown of miR-221 and/or miR-222 restores ERalpha expression and tamoxifen sensitivity.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Glioma [ICD-11: 2A00.1] [20]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• In Vitro Model: SHG-44 cells; Brain; Homo sapiens (Human); CVCL_6728
• In Vitro Model: HEB cells; Brain; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell matrigel invasion assay; Scratch wound assay
• Mechanism Description: Exosomal miR221 targets DNM3 to induce tumor progression and temozolomide resistance in glioma. DNM3 is the target of miR221 and overexpression of DNM3 could reverse the miR221's tumour-promoting effect.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [21]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-221 promotes the invasiveness and trastuzumab resistance of HER2-positive breast cancers by targeting the tumor suppressor gene PTEN.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [22]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [23]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: TRAIL signaling pathway; Inhibition; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: Calu1 cells; Lung; Homo sapiens (Human); CVCL_0608
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of kit and p27kip1 mRNAs, but interfere with TRAIL signaling mainly through p27kip1. miR-221 and -222 modulate TRAIL sensitivity in lung cancer cells mainly by modulating p27kip1 expression and TRAIL-induced caspase machinery.

Investigative 1 drug(s) in total

AGRO100

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [24]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: AGRO100
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: Here we find that nucleolin (NCL), a major nucleolar protein, posttranscriptionally regulates the expression of a specific subset of miRNAs, including miR-21, miR-221, miR-222, and miR-103, that are causally involved in breast cancer initiation, progression, and drug resistance. We also show that NCL is commonly overexpressed in human breast tumors and that its expression correlates with that of NCL-dependent miRNAs.

Disease- and Tissue-specific Abundances of This Molecule

ICD Disease Classification 02

Esophageal cancer [ICD-11: 2B70]

Differential expression of molecule in resistant diseases

• The Studied Tissue: Esophagus
• The Specified Disease: Esophageal carcinoma
• The Expression Level of Disease Section Compare with the Healthy Individual Tissue: p-value: 2.32E-04; Fold-change: 1.25E-01

References

• Ref 1: MicroRNA-221 targeting PI3-K/Akt signaling axis induces cell proliferation and BCNU resistance in human glioblastoma. Neuropathology. 2014 Oct;34(5):455-64. doi: 10.1111/neup.12129. Epub 2014 Apr 30.
• Ref 2: Negative Regulation of PTEN by MicroRNA-221 and Its Association with Drug Resistance and Cellular Senescence in Lung Cancer Cells. Biomed Res Int. 2018 Jan 30;2018:7908950. doi: 10.1155/2018/7908950. eCollection 2018.
• Ref 3: MicroRNA-221 induces cell survival and cisplatin resistance through PI3K/Akt pathway in human osteosarcoma. PLoS One. 2013;8(1):e53906. doi: 10.1371/journal.pone.0053906. Epub 2013 Jan 23.
• Ref 4: Plasma miR-221 as a predictive biomarker for chemoresistance in breast cancer patients who previously received neoadjuvant chemotherapy. Onkologie. 2011;34(12):675-80. doi: 10.1159/000334552. Epub 2011 Nov 23.
• Ref 5: Oral squamous cell carcinoma cells are resistant to doxorubicin through upregulation of miR 221. Mol Med Rep. 2017 Sep;16(3):2659-2667. doi: 10.3892/mmr.2017.6915. Epub 2017 Jul 4.
• Ref 6: p53/mdm2 feedback loop sustains miR-221 expression and dictates the response to anticancer treatments in hepatocellular carcinoma. Mol Cancer Res. 2014 Feb;12(2):203-16. doi: 10.1158/1541-7786.MCR-13-0312-T. Epub 2013 Dec 9.
• Ref 7: Determination of genes and microRNAs involved in the resistance to fludarabine in vivo in chronic lymphocytic leukemia. Mol Cancer. 2010 May 20;9:115. doi: 10.1186/1476-4598-9-115.
• Ref 8: miR-221 Mediates Chemoresistance of Esophageal Adenocarcinoma by Direct Targeting of DKK2 Expression. Ann Surg. 2016 Nov;264(5):804-814. doi: 10.1097/SLA.0000000000001928.
• Ref 9: miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2010 Dec 3;403(1):120-5. doi: 10.1016/j.bbrc.2010.10.130. Epub 2010 Nov 3.
• Ref 10: [Mechanism of miR-221 contributes to gefitinib resistance in PC-9 cells]. Zhonghua Yi Xue Za Zhi. 2018 Nov 13;98(42):3447-3452. doi: 10.3760/cma.j.issn.0376-2491.2018.42.014.
• Ref 11: lncRNA GAS5 Reverses EMT and Tumor Stem Cell-Mediated Gemcitabine Resistance and Metastasis by Targeting miR-221/SOCS3 in Pancreatic Cancer. Mol Ther Nucleic Acids. 2018 Dec 7;13:472-482. doi: 10.1016/j.omtn.2018.09.026. Epub 2018 Oct 6.
• Ref 12: miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. doi: 10.1371/journal.pone.0077623. eCollection 2013.
• Ref 13: A 13 mer LNA-i-miR-221 Inhibitor Restores Drug Sensitivity in Melphalan-Refractory Multiple Myeloma Cells. Clin Cancer Res. 2016 Mar 1;22(5):1222-33. doi: 10.1158/1078-0432.CCR-15-0489. Epub 2015 Nov 2.
• Ref 14: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 15: MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
• Ref 16: In Hepatocellular Carcinoma miR-221 Modulates Sorafenib Resistance through Inhibition of Caspase-3-Mediated Apoptosis. Clin Cancer Res. 2017 Jul 15;23(14):3953-3965. doi: 10.1158/1078-0432.CCR-16-1464. Epub 2017 Jan 17.
• Ref 17: MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.
• Ref 18: Downregulation of miR-221/222 enhances sensitivity of breast cancer cells to tamoxifen through upregulation of TIMP3. Cancer Gene Ther. 2014 Jul;21(7):290-6. doi: 10.1038/cgt.2014.29. Epub 2014 Jun 13.
• Ref 19: MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem. 2008 Nov 7;283(45):31079-86. doi: 10.1074/jbc.M806041200. Epub 2008 Sep 12.
• Ref 20: Exosomal miR-221 targets DNM3 to induce tumor progression and temozolomide resistance in glioma. J Neurooncol. 2017 Jan;131(2):255-265. doi: 10.1007/s11060-016-2308-5. Epub 2016 Nov 11.
• Ref 21: MiR-221 promotes trastuzumab-resistance and metastasis in HER2-positive breast cancers by targeting PTEN. BMB Rep. 2014 May;47(5):268-73. doi: 10.5483/bmbrep.2014.47.5.165.
• Ref 22: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 23: MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55. doi: 10.1038/onc.2008.6. Epub 2008 Feb 4.
• Ref 24: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.