General Information of the Molecule (ID: Mol01403)
Name
hsa-mir-221 ,Homo sapiens
Synonyms
microRNA 221
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR221
Gene ID
407006
Location
chrX:45746157-45746266[-]
Sequence
UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUCGUUAGG
CAACAGCUACAUUGUCUGCUGGGUUUCAGGCUACCUGGAAACAUGUUCUC
    Click to Show/Hide
Ensembl ID
ENSG00000207870
HGNC ID
HGNC:31601
Precursor Accession
MI0000298
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
16 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carmustine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [1]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Carmustine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3-k/PTEN/AKT signaling axis Activation hsa04151
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-221 regulated cell proliferation and BCNU resistance in glioma cells. Overexpression of miR-221 led to cell survival and BCNU resistance and reduced cell apoptosis induced by BCNU, whereas knockdown of miR-221 inhibited cell proliferation and prompted BCNU sensitivity and cell apoptosis. Further investigation revealed that miR-221 down-regulated PTEN and activated Akt, which resulted in cell survival and BCNU resistance. Overexpression of PTEN lacking 3'UTR or PI3-k/Akt specific inhibitor wortmannin attenuated miR-221-mediated BCNU resistance and prompted cell apoptosis. We propose that miR-221 regulated cell proliferation and BCNU resistance in glioma cells by targeting PI3-k/PTEN/Akt signaling axis.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell colony Activation hsa05200
Cell senescence Inhibition hsa04218
Cell viability Activation hsa05200
PTEN/AKT signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; SA-beta-gal assay
Mechanism Description Suppression of miR-221 could lead to increase of PTEN expression level and enhance the CDDP chemosensitivity.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [3]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PI3K/AKT signaling pathway Regulation N.A.
In Vitro Model SOSP-9607 cells Bones Homo sapiens (Human) CVCL_4V80
SOSP-9901 cells Bones Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR; RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-221 induce cell survival and cisplatin resistance in human osteosarcoma at least partly through targeting the PI3k/PTEN/Akt pathway.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Patient treatment and assessment assay
Mechanism Description The expression level of miR-221 was significantly associated with hormone receptor (HR) status. Patients with higher plasma miR-221 levels tended to be HR-negative. plasma miR-221 may be a predictive biomarker for sensitivity to NAC in breast cancer patients.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [5]
Sensitive Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SCC4 cells Tongue Homo sapiens (Human) CVCL_1684
SCC9 cells Tongue Homo sapiens (Human) CVCL_1685
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Annexin V-fluorescein isothiocyanate (FITC)/Hoechst double staining; MTT assay
Mechanism Description OSCC cells are resistant to doxorubicin through upregulation of miR221, which in turn downregulates TIMP3.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [6]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-221 can activate the p53/mdm2 axis by inhibiting MDM2 and, in turn, p53 activation contributes to miR-221 enhanced expression. Moreover, by modulating the p53 axis, miR-221 impacts cell-cycle progression and apoptotic response to doxorubicin in hepatocellular carcinoma-derived cell lines.
Fludarabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic lymphocytic leukemia [ICD-11: 2A82.0] [7]
Resistant Disease Chronic lymphocytic leukemia [ICD-11: 2A82.0]
Resistant Drug Fludarabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Inhibition hsa04115
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description High levels of miR-181a and miR-221 also point to cell cycle progression as both miRNAs repress CDkN1B (p27) expression in hematologic diseases and p27 was also found down-regulated in resistant cells.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [8]
Resistant Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Wnt/Beta-catenin/EMT signaling pathway Activation hsa04310
In Vitro Model OE19 cells Esophagus Homo sapiens (Human) CVCL_1622
OE33 cellss Esophagus Homo sapiens (Human) CVCL_0471
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) staining assay
Mechanism Description miR-221 mediates chemoresistance of esophageal adenocarcinoma by direct targeting and reducing of Dkk2 expression.
Fulvestrant
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [9]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Fulvestrant
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Wnt/beta-catenin signalling pathway Regulation N.A.
TGF-betasignalling pathway Regulation N.A.
p53 signalling pathway Regulation N.A.
MAPK signalling pathway Regulation N.A.
Notch signalling pathway Regulation N.A.
ErbB signalling pathway Regulation N.A.
Jak-STAT signalling pathway Regulation N.A.
Focal Adhesion pathway Regulation N.A.
PI3K/AKT signalling pathway Regulation N.A.
In Vitro Model BT474 cells Breast Homo sapiens (Human) CVCL_0179
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenicity assays; MTT assay
Mechanism Description Activation of beta-catenin by miR-221/222 contributed to estrogen-independent growth and fulvestrant resistance, whereas TGF-beta-mediated growth inhibition was repressed by the two miRNAs
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [10]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
Experiment for
Molecule Alteration
PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-221 may inhibit apoptosis by down regulating the expression of Apaf-1, so as to induce the resistance of PC-9 cells to gefitinib.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [11]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
miR221/SOCS3 signaling pathway Regulation N.A.
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-221 overexpression can promote proliferation, migration, emt, chemotherapy resistance, and stem cell-like properties in panc-1 cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [12]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HuCCT1 cells Bile duct Homo sapiens (Human) CVCL_0324
HuH28 cells Bile duct Homo sapiens (Human) CVCL_2955
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-221 was downregulated in Gem-resistant HuH28 cells, and that it acted as a potent enhancer of Gem sensitivity, at least partly, by downregulating PIk3R1 expression.
Melphalan
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [13]
Resistant Disease Multiple myeloma [ICD-11: 2A83.0]
Resistant Drug Melphalan
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model NCI-H929 cells Bone marrow Homo sapiens (Human) CVCL_1600
U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
RPMI-8226/BTZ cells Pancreas Homo sapiens (Human) CVCL_XK17
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-221/222 expression inversely correlated with melphalan-sensitivity of MM cells. Inhibition of miR-221/222 overcame melphalan-resistance and triggered apoptosis of MM cells in vitro, in the presence or absence of human bone marrow stromal cells. Decreased MM cell growth induced by inhibition of miR-221/222 plus melphalan was associated with a marked upregulation of pro-apoptotic BBC3/PUMA protein, a miR-221/222 target, as well as with modulation of drug influx-efflux transporters SLC7A5/LAT1 and the ATP-binding cassette (ABC) transporter ABCC1/MRP1. Finally, in vivo treatment of SCID/NOD mice bearing human melphalan-refractory MM xenografts with systemic LNA-i-miR-221 plus melphalan overcame drug-resistance, evidenced by growth inhibition with significant antitumor effects together with modulation of PUMA and ABCC1 in tumors retrieved from treated mice.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [14]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Colorectal cancer cells Colon Homo sapiens (Human) N.A.
In Vivo Model Colorectal cancer patients Homo sapiens
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description In line with these findings, we conclude that the increased baseline exosomal expression of miR-92a-3p and miR-221-3p seems to predict a lack of response to chemotherapy and lower OS. However, further prospective studies on more patients are needed before drawing practice-changing conclusions.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [15]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
Experiment for
Molecule Alteration
miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot
Experiment for
Drug Resistance
Apoptosis Assay; Cell Viability Assay
Mechanism Description Taken together, our data strongly support a central role for miR-125b in conferring Taxol resistance through the suppression of Bak1 expression.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [16]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU398 cells Liver Homo sapiens (Human) CVCL_0077
SNU449 cells Liver Homo sapiens (Human) CVCL_0454
SNU475 cells Liver Homo sapiens (Human) CVCL_0497
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Caspase 3/7 activity assay; Cell-titer-Glo assay; Flow cytometry assay
Mechanism Description In hepatocellular carcinoma miR221 modulates sorafenib resistance through inhibition of caspase-3-mediated apoptosis.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [17]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Ectopic expression of miR-221/222 rendered the parental MCF-7 cells resistant to tamoxifen. The protein level of the cell cycle inhibitor p27kip1, a known target of miR-221/222, was reduced by 50% in OHTR cells and by 28-50% in miR-221/222-overexpressing MCF-7 cells. Furthermore, overexpression of p27kip1 in the resistant OHTR cells caused enhanced cell death when exposed to tamoxifen.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [18]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-8 assay
Mechanism Description Transfection of AS-miR-221 and AS-miR-222 dramatically inhibited expression of miR-221 and miR-222, respectively, in both MCF-7 and MDA-MB-231 cells (P<0.05-0.01). Down-regulation of miR-221/222 significantly increased the expression of TIMP3 compared with controls (P<0.05-0.01). The viability of estrogen receptor (ER)-positive MCF-7 cells transfected with AS-miR-221 or/and AS-miR-222 was significantly reduced by tamoxifen (P<0.05-0.01). Suppression of miRNA-221/222 increases the sensitivity of ER-positive MCF-7 breast cancer cells to tamoxifen. This effect is mediated through upregulation of TIMP3. These findings suggest that upregulation of TIMP3 via inhibition of miRNA-221/222 could be a promising therapeutic approach for breast cancer.
Disease Class: Breast cancer [ICD-11: 2C60.3] [19]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT474 cells Breast Homo sapiens (Human) CVCL_0179
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-MB-157 cells Breast Homo sapiens (Human) CVCL_0618
MDA-MB-361 cells Breast Homo sapiens (Human) CVCL_0620
MDA-MB-435s cells Breast Homo sapiens (Human) CVCL_0622
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-221 and miR-222 are frequently up-regulated in ERalpha-negative breast cancer cell lines and primary tumors. The elevated level of miR-221 and miR-222 is responsible for a subset of ERalpha-negative breast tumors that express ERalpha mRNA. Furthermore, overexpression of miR-221 and miR-222 contributes to tamoxifen resistance through negative regulation of ERalpha, whereas knockdown of miR-221 and/or miR-222 restores ERalpha expression and tamoxifen sensitivity.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [20]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87MG cells Brain Homo sapiens (Human) CVCL_GP63
SHG-44 cells Brain Homo sapiens (Human) CVCL_6728
HEB cells Brain Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Transwell matrigel invasion assay; Scratch wound assay
Mechanism Description Exosomal miR221 targets DNM3 to induce tumor progression and temozolomide resistance in glioma. DNM3 is the target of miR221 and overexpression of DNM3 could reverse the miR221's tumour-promoting effect.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [21]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-221 promotes the invasiveness and trastuzumab resistance of HER2-positive breast cancers by targeting the tumor suppressor gene PTEN.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [22]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [23]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
TRAIL signaling pathway Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
Calu1 cells Lung Homo sapiens (Human) CVCL_0608
Experiment for
Molecule Alteration
qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description H460-sensitive cells treated with -221 and -222 pre-miRs become resistant to TRAIL. miR-221 and -222 target the 3'-UTR of kit and p27kip1 mRNAs, but interfere with TRAIL signaling mainly through p27kip1. miR-221 and -222 modulate TRAIL sensitivity in lung cancer cells mainly by modulating p27kip1 expression and TRAIL-induced caspase machinery.
Investigative
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
AGRO100
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [24]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug AGRO100
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry analysis
Mechanism Description Here we find that nucleolin (NCL), a major nucleolar protein, posttranscriptionally regulates the expression of a specific subset of miRNAs, including miR-21, miR-221, miR-222, and miR-103, that are causally involved in breast cancer initiation, progression, and drug resistance. We also show that NCL is commonly overexpressed in human breast tumors and that its expression correlates with that of NCL-dependent miRNAs.
Disease- and Tissue-specific Abundances of This Molecule
ICD Disease Classification 02
Click to Show/Hide the Resistance Disease of This Class
Esophageal cancer [ICD-11: 2B70]
Click to Show/Hide
Differential expression of molecule in resistant diseases
The Studied Tissue Esophagus
The Specified Disease Esophageal carcinoma
The Expression Level of Disease Section Compare with the Healthy Individual Tissue p-value: 2.32E-04; Fold-change: 1.25E-01
Molecule expression in the diseased tissue of patients
Molecule expression in the normal tissue of healthy individuals
Disease-specific Molecule Abundances Click to View the Clearer Original Diagram
References
Ref 1 MicroRNA-221 targeting PI3-K/Akt signaling axis induces cell proliferation and BCNU resistance in human glioblastoma. Neuropathology. 2014 Oct;34(5):455-64. doi: 10.1111/neup.12129. Epub 2014 Apr 30.
Ref 2 Negative Regulation of PTEN by MicroRNA-221 and Its Association with Drug Resistance and Cellular Senescence in Lung Cancer Cells. Biomed Res Int. 2018 Jan 30;2018:7908950. doi: 10.1155/2018/7908950. eCollection 2018.
Ref 3 MicroRNA-221 induces cell survival and cisplatin resistance through PI3K/Akt pathway in human osteosarcoma. PLoS One. 2013;8(1):e53906. doi: 10.1371/journal.pone.0053906. Epub 2013 Jan 23.
Ref 4 Plasma miR-221 as a predictive biomarker for chemoresistance in breast cancer patients who previously received neoadjuvant chemotherapy. Onkologie. 2011;34(12):675-80. doi: 10.1159/000334552. Epub 2011 Nov 23.
Ref 5 Oral squamous cell carcinoma cells are resistant to doxorubicin through upregulation of miR 221. Mol Med Rep. 2017 Sep;16(3):2659-2667. doi: 10.3892/mmr.2017.6915. Epub 2017 Jul 4.
Ref 6 p53/mdm2 feedback loop sustains miR-221 expression and dictates the response to anticancer treatments in hepatocellular carcinoma. Mol Cancer Res. 2014 Feb;12(2):203-16. doi: 10.1158/1541-7786.MCR-13-0312-T. Epub 2013 Dec 9.
Ref 7 Determination of genes and microRNAs involved in the resistance to fludarabine in vivo in chronic lymphocytic leukemia. Mol Cancer. 2010 May 20;9:115. doi: 10.1186/1476-4598-9-115.
Ref 8 miR-221 Mediates Chemoresistance of Esophageal Adenocarcinoma by Direct Targeting of DKK2 Expression. Ann Surg. 2016 Nov;264(5):804-814. doi: 10.1097/SLA.0000000000001928.
Ref 9 miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2010 Dec 3;403(1):120-5. doi: 10.1016/j.bbrc.2010.10.130. Epub 2010 Nov 3.
Ref 10 [Mechanism of miR-221 contributes to gefitinib resistance in PC-9 cells]. Zhonghua Yi Xue Za Zhi. 2018 Nov 13;98(42):3447-3452. doi: 10.3760/cma.j.issn.0376-2491.2018.42.014.
Ref 11 lncRNA GAS5 Reverses EMT and Tumor Stem Cell-Mediated Gemcitabine Resistance and Metastasis by Targeting miR-221/SOCS3 in Pancreatic Cancer. Mol Ther Nucleic Acids. 2018 Dec 7;13:472-482. doi: 10.1016/j.omtn.2018.09.026. Epub 2018 Oct 6.
Ref 12 miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. doi: 10.1371/journal.pone.0077623. eCollection 2013.
Ref 13 A 13 mer LNA-i-miR-221 Inhibitor Restores Drug Sensitivity in Melphalan-Refractory Multiple Myeloma Cells. Clin Cancer Res. 2016 Mar 1;22(5):1222-33. doi: 10.1158/1078-0432.CCR-15-0489. Epub 2015 Nov 2.
Ref 14 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 15 MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
Ref 16 In Hepatocellular Carcinoma miR-221 Modulates Sorafenib Resistance through Inhibition of Caspase-3-Mediated Apoptosis. Clin Cancer Res. 2017 Jul 15;23(14):3953-3965. doi: 10.1158/1078-0432.CCR-16-1464. Epub 2017 Jan 17.
Ref 17 MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.
Ref 18 Downregulation of miR-221/222 enhances sensitivity of breast cancer cells to tamoxifen through upregulation of TIMP3. Cancer Gene Ther. 2014 Jul;21(7):290-6. doi: 10.1038/cgt.2014.29. Epub 2014 Jun 13.
Ref 19 MicroRNA-221/222 negatively regulates estrogen receptor alpha and is associated with tamoxifen resistance in breast cancer. J Biol Chem. 2008 Nov 7;283(45):31079-86. doi: 10.1074/jbc.M806041200. Epub 2008 Sep 12.
Ref 20 Exosomal miR-221 targets DNM3 to induce tumor progression and temozolomide resistance in glioma. J Neurooncol. 2017 Jan;131(2):255-265. doi: 10.1007/s11060-016-2308-5. Epub 2016 Nov 11.
Ref 21 MiR-221 promotes trastuzumab-resistance and metastasis in HER2-positive breast cancers by targeting PTEN. BMB Rep. 2014 May;47(5):268-73. doi: 10.5483/bmbrep.2014.47.5.165.
Ref 22 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 23 MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55. doi: 10.1038/onc.2008.6. Epub 2008 Feb 4.
Ref 24 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.