General Information of the Molecule (ID: Mol01384)
Name
hsa-mir-181 ,Homo sapiens
Synonyms
microRNA 181b-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR181B1
Gene ID
406955
Location
chr1:198858873-198858982[-]
Sequence
CCUGUGCAGAGAUUAUUUUUUAAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUG
AACUGUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCGCUU
    Click to Show/Hide
Ensembl ID
ENSG00000207975
HGNC ID
HGNC:31550
Precursor Accession
MI0000270
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
PTEN/PI3K/AKT signaling pathway Inhibition hsa05235
In Vitro Model A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-181 downregulation promoted cell growth and metastasis and inhibited cell apoptosis and suppressed LC3 and ATG5 protein expression in A549/DDP cells through suppression of the PTEN/PI3k/AkT/mTOR pathway, whereas miR-181 overexpression recovered LC3 and ATG5 protein expression by promoting PTEN/PI3k/AkT/mTOR signaling.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Notch2/HES1 signaling pathway Inhibition hsa04330
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Ectopic miR-181b expression suppressed cancer stem cell properties and enhanced sensitivity to cisplatin (DDP) treatment by directly targeting Notch2.
Disease Class: Non-small cell lung cancer [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Inhibition hsa05200
TGF-BetaR1/Smad signaling pathway Inhibition hsa04350
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-181b inhibited cell proliferation, augmented the chemosensitivity to DDP, suppressed migration and invasion in NSCLC cells miR-181b inhibited cell proliferation, augmented the chemosensitivity to DDP, suppressed migration and invasion in NSCLC cells in vitro and in vivo. Furthermore, miR-181b may increase chemosensitivity to DDP and suppress the invasion and metastasis of NSCLC cells through directly targeting the TGFbetaR1 signaling miR-181b may increase chemosensitivity to DDP and suppress the invasion and metastasis of NSCLC cells through directly targeting the TGFbetaR1 signaling pathway.
Disease Class: Gastric adenocarcinoma [4]
Sensitive Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Cytarabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [5]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Sensitive Drug Cytarabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The ectopic expression of miR-181b in k562/A02 and HL-60/ADM cells robustly suppressed endogenous HMGB1 and Mcl-1 expression both at mRNA and protein levels. Conversely, knockdown of miR-181b by miR-181b inhibitor markedly increased the expression of both HMGB1 and Mcl-1. Restoration of miR-181b increased the drug sensitivity of AML MDR cells by targeting HMGB1 and Mcl-1.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
miR181b/Bim/MMP/caspase signaling pathway Regulation hsa05206
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description The miR-181b level was significantly upregulated in patient serum and breast cancer cell lines compared with that in normal controls. The results of in vitro 3H thymidine incorporation and Transwell migration assay indicated that miR-181b overexpression markedly promoted the proliferation and metastasis of breast cancer cells. These data suggest that miR-181b is a tumor promoter in breast cancer. Furthermore, miR-181b expression was found to be upregulated in doxorubicin (DOX)-resistant T-47D cells (T-47D-R) compared with that in the parental T-47D cells, and upregulation of miR-181b expression decreased the anticancer effect of DOX in the T-47D cells. Mechanistic studies demonstrated that the Bim gene, an essential initiator of apoptosis, was inhibited by miR-181b overexpression. knockdown of miR-181b by its specific inhibitors significantly re-sensitized the T-47D-R cells to the cytotoxicity of DOX. miR-181b inhibitors increased the level of Bim in the T-47D-R cells, resulting in the loss of mitochondrial membrane potential (MMP) and the activation of caspases caused by DOX.
Disease Class: Hepatocellular carcinoma [7]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
TGF-beta signaling pathway Activation hsa04350
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description TIMP3 is a tumor suppressor and a validated miR-181 target. Ectopic expression and depletion of miR-181b showed that miR-181b enhanced MMP2 and MMP9 activity and promoted growth, clonogenic survival, migration and invasion of HCC cells that could be reversed by modulating TIMP3 level.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [5]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The ectopic expression of miR-181b in k562/A02 and HL-60/ADM cells robustly suppressed endogenous HMGB1 and Mcl-1 expression both at mRNA and protein levels. Conversely, knockdown of miR-181b by miR-181b inhibitor markedly increased the expression of both HMGB1 and Mcl-1. Restoration of miR-181b increased the drug sensitivity of AML MDR cells by targeting HMGB1 and Mcl-1.
Disease Class: Gastric adenocarcinoma [4]
Sensitive Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric adenocarcinoma [4]
Sensitive Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Fludarabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic lymphocytic leukemia [8]
Sensitive Disease Chronic lymphocytic leukemia [ICD-11: 2A82.0]
Sensitive Drug Fludarabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model CLL B cells Lymph Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-181a and miR-181b directly inhibit the expression of BCL-2, MCL-1 and XIAP by binding to the target sequence, sensitizes CLL cells to fludarabine-induced apoptosis.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric adenocarcinoma [4]
Sensitive Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [9]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
NF-kappaB signaling pathway Regulation hsa04064
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Panc1 cells Pancreas Homo sapiens (Human) CVCL_0480
PSN1 cells Pancreas Homo sapiens (Human) CVCL_1644
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-181b enhances the activity of NF-kB by inhibiting CYLD, thus leading to the resistance to gemcitabine.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [10]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
CFPAC1 cells Pancreas Homo sapiens (Human) CVCL_1119
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description BCL-2 facilitates cell survival against chemotherapy via the blockage of Bax/Bak-induced apoptosis, miRNA-181b sensitizes PDAC cells to gemcitabine by targeting BCL-2.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma multiforme [11]
Sensitive Disease Glioblastoma multiforme [ICD-11: 2A00.03]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation EGFR signaling pathway Inhibition hsa01521
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description miR181b modulates chemosensitivity of glioblastoma multiforme cells to temozolomide by targeting the epidermal growth factor receptor.
Disease Class: Glioblastoma [12]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma.
Disease Class: Glioma [13]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
MAPK signaling pathway Inhibition hsa04010
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-181b independently predicted chemoresponse to temozolomide and enhanced temozolomide sensitivity via MEk1 downregulation.
Teniposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [14]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Teniposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description MDM2 is a candidate target of miR-181b. MDM2 knockdown mimicked the sensitization effect of miR-181b. Further study revealed that miR-181b binds to the 3'-UTR region of MDM2 leading to the decrease in MDM2 levels and subsequent increase in teniposide sensitivity. Partial restoration of MDM2 attenuated the sensitivity enhancement by miR-181b.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric adenocarcinoma [4]
Sensitive Disease Gastric adenocarcinoma [ICD-11: 2B72.0]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The antiapoptotic protein BCL2 is upregulated, whereas miR-181b is downregulated in both SGC7901/VCR and A549/CDDP cells, compared with SGC7901 and A549 cells, respectively. Enforced miR-181b expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, respectively.
References
Ref 1 miR-181 regulates cisplatin-resistant non-small cell lung cancer via downregulation of autophagy through the PTEN/PI3K/AKT pathway. Oncol Rep. 2018 Apr;39(4):1631-1639. doi: 10.3892/or.2018.6268. Epub 2018 Feb 13.
Ref 2 miR-181b/Notch2 overcome chemoresistance by regulating cancer stem cell-like properties in NSCLC. Stem Cell Res Ther. 2018 Nov 23;9(1):327. doi: 10.1186/s13287-018-1072-1.
Ref 3 MiR-181b regulates cisplatin chemosensitivity and metastasis by targeting TGFBetaR1/Smad signaling pathway in NSCLC. Sci Rep. 2015 Dec 1;5:17618. doi: 10.1038/srep17618.
Ref 4 miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.
Ref 5 miR-181b increases drug sensitivity in acute myeloid leukemia via targeting HMGB1 and Mcl-1. Int J Oncol. 2014 Jul;45(1):383-92. doi: 10.3892/ijo.2014.2390. Epub 2014 Apr 16.
Ref 6 MiR-181b promotes chemoresistance in breast cancer by regulating Bim expression. Oncol Rep. 2016 Feb;35(2):683-90. doi: 10.3892/or.2015.4417. Epub 2015 Nov 13.
Ref 7 TGFbeta-mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. Oncogene. 2010 Mar 25;29(12):1787-97. doi: 10.1038/onc.2009.468. Epub 2009 Dec 21.
Ref 8 miR-181a/b significantly enhances drug sensitivity in chronic lymphocytic leukemia cells via targeting multiple anti-apoptosis genes. Carcinogenesis. 2012 Jul;33(7):1294-301. doi: 10.1093/carcin/bgs179. Epub 2012 May 18.
Ref 9 Involvement of microRNA-181b in the gemcitabine resistance of pancreatic cancer cells. Pancreatology. 2013 Sep-Oct;13(5):517-23. doi: 10.1016/j.pan.2013.06.007. Epub 2013 Jun 28.
Ref 10 miRNA-181b increases the sensitivity of pancreatic ductal adenocarcinoma cells to gemcitabine in vitro and in nude mice by targeting BCL-2. Oncol Rep. 2013 May;29(5):1769-76. doi: 10.3892/or.2013.2297. Epub 2013 Feb 21.
Ref 11 MiR-181b modulates chemosensitivity of glioblastoma multiforme cells to temozolomide by targeting the epidermal growth factor receptor. J Neurooncol. 2017 Jul;133(3):477-485. doi: 10.1007/s11060-017-2463-3. Epub 2017 May 13.
Ref 12 miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells. Med Oncol. 2014 Apr;31(4):892. doi: 10.1007/s12032-014-0892-9. Epub 2014 Feb 27.
Ref 13 miR-181b modulates glioma cell sensitivity to temozolomide by targeting MEK1. Cancer Chemother Pharmacol. 2013 Jul;72(1):147-58. doi: 10.1007/s00280-013-2180-3. Epub 2013 May 5.
Ref 14 MiR-181b sensitizes glioma cells to teniposide by targeting MDM2. BMC Cancer. 2014 Aug 25;14:611. doi: 10.1186/1471-2407-14-611.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.