Molecule Information

General Information of the Molecule (ID: Mol01360)

• Name: hsa-mir-99a ,Homo sapiens
• Synonyms: microRNA 99a
• Molecule Type: Precursor miRNA
• Gene Name: MIR99A
• Gene ID: 407055
• Location: chr21:16539089-16539169[+]
• Sequence:
  CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUU
  CUAUGGGUCUGUGUCAGUGUG
• Ensembl ID: ENSG00000207638
• HGNC ID: HGNC:31650
• Precursor Accession: MI0000101

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Fluorouracil

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: mTOR signalling pathway; Regulation; N.A.
• In Vitro Model: Colorectal cancer cells; Colon; Homo sapiens (Human); N.A.
• In Vivo Model: Colorectal cancer serum samples; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; TaqMan low-density arrays
• Experiment for Drug Resistance: Detection of CA19-9 and CEA
• Mechanism Description: In this study, the expression levels of serum miRNAs in patients with CRC have been systematically determined and five serum miRNAs (miR-20a, miR-130, miR-145, miR-216 and miR-372) have been identified that are significantly upregulated in oxaliplatin-chemoresistant CRC patients compared with chemosensitive patients.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assay; Clonogenic assay
• Mechanism Description: Inhibition of miR99a and miR491, or overexpress CAPNS1 can enhance cisplatin sensitivity of the resistant cells. miR99a and miR491 might be work as novel molecules regulate cisplatin resistance by directly targeting CAPNS1 associated pathway in human gastric cancer cells.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [3]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [4]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-99a is increased.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [6]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: ETV6-RUNX1-positive Reh cells; Blood; Homo sapiens (Human); CVCL_1650
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL).

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: MiR-99a and MiR-491 Regulate Cisplatin Resistance in Human Gastric Cancer Cells by Targeting CAPNS1. Int J Biol Sci. 2016 Nov 5;12(12):1437-1447. doi: 10.7150/ijbs.16529. eCollection 2016.
• Ref 3: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 4: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 5: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 6: MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leuk Res. 2013 Oct;37(10):1315-21. doi: 10.1016/j.leukres.2013.06.027. Epub 2013 Jul 31.