Molecule Information
General Information of the Molecule (ID: Mol01360)
Name |
hsa-mir-99a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 99a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR99A
|
||||
Gene ID | |||||
Location |
chr21:16539089-16539169[+]
|
||||
Sequence |
CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUU
CUAUGGGUCUGUGUCAGUGUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
TUNEL assay; Clonogenic assay | |||
Mechanism Description | Inhibition of miR99a and miR491, or overexpress CAPNS1 can enhance cisplatin sensitivity of the resistant cells. miR99a and miR491 might be work as novel molecules regulate cisplatin resistance by directly targeting CAPNS1 associated pathway in human gastric cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Acute lymphocytic leukemia | [2] | |||
Resistant Disease | Acute lymphocytic leukemia [ICD-11: 2B33.0] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | ETV6-RUNX1-positive Reh cells | Blood | Homo sapiens (Human) | CVCL_1650 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL). |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.