Molecule Information

General Information of the Molecule (ID: Mol01342)

• Name: hsa-mir-20a ,Homo sapiens
• Synonyms: microRNA 20a
• Molecule Type: Precursor miRNA
• Gene Name: MIR20A
• Gene ID: 406982
• Location: chr13:91351065-91351135[+]
• Sequence:
  GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACU
  UAAAGUACUGC
• Ensembl ID: ENSG00000283762
• HGNC ID: HGNC:31577
• Precursor Accession: MI0000076

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 11 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: NF-kappaB signaling pathway; Activation; hsa04064
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Flow cytometry assay; MTT assay
• Mechanism Description: miR-20a directly targeted CYLD, resulting in activation of the NFkB pathway and the downstream targets, livin and survivin, which potentially contributed to GC chemoresistance.

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: EGR2 signaling pathway; Inhibition; hsa04625
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: NUGC3 cells; Gastric; Homo sapiens (Human); CVCL_1612
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-20a promoted the growth, migration and invasion of GC cells, enhanced the chemoresistance of GC cells to cisplatin and docetaxel. Luciferase activity and Western blot confirmed that miR-20a negatively regulated EGR2 expression. Overexpression of EGR2 significantly attenuated the oncogenic effect of miR-20a.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: TGF-beta signaling pathway; Activation; hsa04350
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8-8 assay; Transwell migration assay; Promega assay
• Mechanism Description: miR-17, 20a, 20b were down-regulation in cisplatin-resistant A549/DDP cells compared with A549 cells. inhibition of miR-17, 20a, 20b increased cisplatin-resistant and migration of A549 cells, and over-expression of miR-17, 20a, 20b decreased cisplatin-resistant and migration of A549/DDP cells. miR-17, 20a, 20b blunted the TGFbeta signal pathway by directly inhibiting its important component TGFbetaR2. TGFbetaR2 silenced led to cisplatin sensitivity and migration inhibition in A549/DDP cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [4]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: ROS/ASk1/JNk signaling pathway; Activation; hsa04071
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Knockdown of miR-20a enhanced sensitivity of colorectal cancer cells to cisplatin through the ROS/ASk1/JNk pathway.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: EGR2 signaling pathway; Inhibition; hsa04625
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: NUGC3 cells; Gastric; Homo sapiens (Human); CVCL_1612
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-20a promoted the growth, migration and invasion of GC cells, enhanced the chemoresistance of GC cells to cisplatin and docetaxel. Luciferase activity and Western blot confirmed that miR-20a negatively regulated EGR2 expression. Overexpression of EGR2 significantly attenuated the oncogenic effect of miR-20a.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: MAPK/ERK signaling pathway; Inhibition; hsa04010
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The restoration of miR-20a expression significantly reduced LRIG1-induced GC cell chemosensitivity.

Etoposide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [6]

• Sensitive Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Immunofluorescence; Confocal microscopy assay; qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assays; Apoptosis assays
• Mechanism Description: Mechanistic investigations revealed that oridonin upregulated BIM-S by diminishing the expression of miR-17 and miR-20a, leading to mitochondria-dependent apoptosis. In contrast, neither Ara-C nor VP-16 could reduce miR-17 and miR-20a expression or could trigger BIM-S-mediated apoptosis. Notably, silencing miR-17 or miR-20a expression by treatment with microRNA (miRNA; miR) inhibitors or oridonin restored sensitivity of K562 cells to VP-16. Synergistic effects of oridonin and VP-16 were documented in cultured cells as well as mouse tumor xenograft assays. Inhibiting miR-17 or miR-20a also augmented the proapoptotic activity of oridonin. Taken together, our results identify a miRNA-dependent mechanism underlying the anticancer effect of oridonin and provide a rationale for its combination with chemotherapy drugs in addressing chemoresistant leukemia cells.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] [7]

• Sensitive Disease: Colorectal adenocarcinoma [ICD-11: 2B91.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-20a overexpression resulted in resistance to these chemotherapy agents, while miR-20a knockdown led to sensitization, miR-20a down-regulated both BNIP2 mRNA and BNIP2 protein levels. miR-20a down-regulated the expression of the proapoptotic factor BNIP2, leading to an imbalance of anti-apoptosis and pro-apoptosis factors, resulting in the blockage of events leading to apoptosis.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [8]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: RT112 cells; Bladder; Homo sapiens (Human); CVCL_1670
• Experiment for Molecule Alteration: Western blot; Microarray Analysis; qRT-PCR
• Experiment for Drug Resistance: Proliferation Assay
• Mechanism Description: Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] [7]

• Sensitive Disease: Colorectal adenocarcinoma [ICD-11: 2B91.2]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-20a overexpression resulted in resistance to these chemotherapy agents, while miR-20a knockdown led to sensitization, miR-20a down-regulated both BNIP2 mRNA and BNIP2 protein levels. miR-20a down-regulated the expression of the proapoptotic factor BNIP2, leading to an imbalance of anti-apoptosis and pro-apoptosis factors, resulting in the blockage of events leading to apoptosis.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [6]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• Experiment for Molecule Alteration: Micro Array Expression Analysis; qRT-PCR; Luciferase Reporter assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Micro-RNA profiles of paclitaxel resistant and paclitaxel sensitive A549 cells. The expression level of hsa-mir-20a has decreased.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Teniposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal adenocarcinoma [ICD-11: 2B91.2] [7]

• Sensitive Disease: Colorectal adenocarcinoma [ICD-11: 2B91.2]
• Sensitive Drug: Teniposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-20a overexpression resulted in resistance to these chemotherapy agents, while miR-20a knockdown led to sensitization, miR-20a down-regulated both BNIP2 mRNA and BNIP2 protein levels. miR-20a down-regulated the expression of the proapoptotic factor BNIP2, leading to an imbalance of anti-apoptosis and pro-apoptosis factors, resulting in the blockage of events leading to apoptosis.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: MAPK/ERK signaling pathway; Inhibition; hsa04010
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The restoration of miR-20a expression significantly reduced LRIG1-induced GC cell chemosensitivity.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [10]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: TBID/Mitochondria signaling pathway; Activation; hsa04217
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: NCI-H508 cells; Colon; Homo sapiens (Human); CVCL_1564
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: SW948 cells; Colon; Homo sapiens (Human); CVCL_0632
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; FITC-Annexin V and propidium iodide (PI) assay
• Mechanism Description: The knockdown of miR20a inhibited the translocation of tBID to the mitochondria, which induced the mitochondrial pathway of apoptosis, the knockdown of miR20a also reversed the resistance of TRAIL in established TRAIL-resistant SW480 cells by tBID-mitochondria pathway.

References

• Ref 1: miR-20a induces cisplatin resistance of a human gastric cancer cell line via targeting CYLD. Mol Med Rep. 2016 Aug;14(2):1742-50. doi: 10.3892/mmr.2016.5413. Epub 2016 Jun 21.
• Ref 2: Involvement of miR-20a in promoting gastric cancer progression by targeting early growth response 2 (EGR2). Int J Mol Sci. 2013 Aug 6;14(8):16226-39. doi: 10.3390/ijms140816226.
• Ref 3: MiRNA 17 family regulates cisplatin-resistant and metastasis by targeting TGFbetaR2 in NSCLC. PLoS One. 2014 Apr 10;9(4):e94639. doi: 10.1371/journal.pone.0094639. eCollection 2014.
• Ref 4: Knockdown of MiR-20a Enhances Sensitivity of Colorectal Cancer Cells to Cisplatin by Increasing ASK1 Expression. Cell Physiol Biochem. 2018;47(4):1432-1441. doi: 10.1159/000490834. Epub 2018 Jun 19.
• Ref 5: Downregulation of leucine-rich repeats and immunoglobulin-like domains 1 by microRNA-20a modulates gastric cancer multidrug resistance. Cancer Sci. 2018 Apr;109(4):1044-1054. doi: 10.1111/cas.13538. Epub 2018 Mar 23.
• Ref 6: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 7: miR-20a targets BNIP2 and contributes chemotherapeutic resistance in colorectal adenocarcinoma SW480 and SW620 cell lines. Acta Biochim Biophys Sin (Shanghai). 2011 Mar;43(3):217-25. doi: 10.1093/abbs/gmq125. Epub 2011 Jan 17.
• Ref 8: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 9: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 10: miR-20a-directed regulation of BID is associated with the TRAIL sensitivity in colorectal cancer. Oncol Rep. 2017 Jan;37(1):571-578. doi: 10.3892/or.2016.5278. Epub 2016 Nov 28.