Molecule Information

General Information of the Molecule (ID: Mol01381)

• Name: hsa-mir-34 ,Homo sapiens
• Synonyms: microRNA 34a
• Molecule Type: Precursor miRNA
• Gene Name: MIR34A
• Gene ID: 407040
• Location: chr1:9151668-9151777[-]
• Sequence:
  GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGG
  AAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC
• Ensembl ID: ENSG00000284357
• HGNC ID: HGNC:31635
• Precursor Accession: MI0000268

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 16 drug(s) in total

Carboplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAGE-A/p53 signaling pathway; Regulation; hsa04115
• In Vitro Model: HXO-Rb44 cells; Retina; Homo sapiens (Human); CVCL_D542
• In Vitro Model: SO-Rb50 cells; Retina; Homo sapiens (Human); CVCL_D543
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• In Vitro Model: Y79 cells; Retina; Homo sapiens (Human); CVCL_1893
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Freedom Evolyzer-2200 Enzyme-Linked Immunometric meter; Flow cytometry assay
• Mechanism Description: miR-34a may function as a tumor suppressor for RB by targeting MAGE-A and upregulating p53 expression to enhance cell apoptosis and chemosensitivity (Carboplatin; Etoposide; Adriamycin; vincristine).

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2], [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Activation; hsa01521
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• Cell Pathway Regulation: Wnt/beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Balb/c athymic nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: HOTAIR recruit the PRC2 complex to silence miR34a via H3k27me3 modification. HOTAIR knockdown inhibited DDP resistance of gastric cancer cells by upregulating miR-34a.

Disease Class: Gastric cancer [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PI3K signaling pathway; Regulation; hsa04151
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The downregulation of miR-34a (+) the resistance of human GC cells to DDP treatment through regulation of cell proliferation and apoptosis via the regulation of the MET gene.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Dual-luciferase report assay; RNA immunoprecipitation (RIP) assay; qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity detection; MTT assay
• Mechanism Description: Knockdown of long non-coding RNA HOTAIR inhibits cisplatin resistance of gastric cancer cells through inhibiting the PI3k/Akt and Wnt/beta-catenin signaling pathways by up-regulating miR34a.

Disease Class: Osteosarcoma [5]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Bim signaling pathway; Activation; hsa05206
• Cell Pathway Regulation: c-Myc signaling pathway; Activation; hsa05230
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR34a increases cisplatin sensitivity of osteosarcoma cells in vitro through up-regulation of c-Myc and Bim signal.

Disease Class: Lung cancer [6]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: BEAS-2B cells; Bronchus; Homo sapiens (Human); CVCL_0168
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR34a sensitizes lung cancer cells to cisplatin via p53/miR34a/MYCN axis, miR34a directly targeted to MYCN to sensitize NSCLC cells to cisplatin.

Disease Class: Ovarian cancer [7]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Soft agar colony formation assay
• Mechanism Description: miR-34a exhibited suppressive effects on OC cells via directly binding and downregulating HDAC1 expression, which subsequently decreased the resistance to cisplatin and suppressed proliferation in OC cells.

Disease Class: Bladder cancer [8]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: HT1376 cells; Bladder; Homo sapiens (Human); CVCL_1292
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Tumorigenicity in nude mice
• Mechanism Description: Cisplatin-based chemotherapy induced demethylation of miR-34a promoter and increased miR-34a expression, which in turn sensitized MIBC cells to cisplatin and decreased the tumorigenicity and proliferation of cancer cells that by reducing the production of CD44.

Disease Class: Gastric cancer [9]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT/survivin signaling pathway; Inhibition; hsa04151
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC-7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-34aexpression was down-regulated in cisplatin-resistant cell lines.miR-34a over-expression could improve the sensitivity ofgastric cancer cells against cisplatin-based chemotherapies,with PI3k/AkT/survivin signaling pathway possibly involvedin the mechanism.

Disease Class: Lung cancer [10]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SBC5 cells; Lung; Homo sapiens (Human); CVCL_1679
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Cells pretreated with siR-Sirt1 are more sensitive to DDP than the control pretreated cells, miR-34a down-regulation Sirt1 and sensitizes lung cancer cell lines to DDP.

Disease Class: Bladder cancer [11]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: TCCSuP cells; Bladder; Homo sapiens (Human); CVCL_1738
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Cdk6, in complex with Cdk4 and cyclin D1, is a key regulator of Rb activity and thereby G1/S transition, SIRT-1 is a deacetylase whose targets including p53, FOXO, SFRP1 and PGC1. Transfection with pre-miR-34a increases chemo-sensitivity to cisplatin through inhibition of Cdk6 and SIRT-1.

Disease Class: Medulloblastoma [12]

• Sensitive Disease: Medulloblastoma [ICD-11: 2A00.10]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: UW228 cells; Brain; Homo sapiens (Human); CVCL_8585
• In Vitro Model: R262 cells; Bone marrow; Homo sapiens (Human); CVCL_VU83
• In Vitro Model: R300 cells; Bone marrow; Homo sapiens (Human); CVCL_VU84
• In Vitro Model: UW426 cells; Bone marrow; Homo sapiens (Human); CVCL_DH82
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The repression of MAGE-A by miR-34a results in increased expression of p53 thus lead to resistance.

Disease Class: Gastric cancer [13]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: KATO-3 cells; Gastric; Homo sapiens (Human); CVCL_0371
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Human gastric cancer kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor, miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [14]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: 22RV1 cells; Prostate; Homo sapiens (Human); CVCL_1045
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Acid phosphatase assay
• Mechanism Description: miR-34a regulates BCL-2 and may, in part, regulate response to docetaxel. miR-34a was significantly decreased in prostate cancer versus normal tissues; in biochemical recurrence versus non-recurrence tissue and in metastatic versus primary disease prostate tissue. We confirmed BCL-2 as a target of miR-34a, by manipulating miR-34a expression in our parent and docetaxel resistant cell lines and subsequently assessing BCL-2 levels. Specifically, upon inhibition of miR-34a in sensitive parent cells (PC3 and 22Rv1) we observed an increase in BCL-2 expression, whereas mimicking miR-34a expression in docetaxel-resistant cells (PC3RD and 22Rv1RD) resulted in decreased BCL-2 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [15]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Docetaxel primarily acts in G2-M phase, whereas it has diminished activity in G1 phase. Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Disease Class: Gastric cancer [13]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: KATO-3 cells; Gastric; Homo sapiens (Human); CVCL_0371
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Human gastric cancer kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor, miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Prostate cancer [16]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: PrEC cells; Prostate; Homo sapiens (Human); CVCL_0061
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR27b and miR34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [17]

• Resistant Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: HS-5 cells; Bone marrow; Homo sapiens (Human); CVCL_3720
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: TUG1 epigenetically suppressed miR-34a expression by recruiting EZH2 to the promoter region of miR-34a and increasing H3k27me3 level to confer adriamycin resistance in acute myeloid leukemia.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAGE-A/p53 signaling pathway; Regulation; hsa04115
• In Vitro Model: HXO-Rb44 cells; Retina; Homo sapiens (Human); CVCL_D542
• In Vitro Model: SO-Rb50 cells; Retina; Homo sapiens (Human); CVCL_D543
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• In Vitro Model: Y79 cells; Retina; Homo sapiens (Human); CVCL_1893
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Freedom Evolyzer-2200 Enzyme-Linked Immunometric meter; Flow cytometry assay
• Mechanism Description: miR-34a may function as a tumor suppressor for RB by targeting MAGE-A and upregulating p53 expression to enhance cell apoptosis and chemosensitivity (Carboplatin; Etoposide; Adriamycin; vincristine).

Disease Class: Breast cancer [18]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-34a negatively regulates the expression of Notch1 at mRNA and protein levels, and overexpression of Mir-34A can increase the drug sensitivity of breast cancer cells to ADR.

Disease Class: Breast cancer [19]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR34a/Notch1 signaling pathway; Regulation; hsa05206
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: XTT assay; Flow cytometry assay
• Mechanism Description: Primary and mature miR34a were suppressed by treatment with p53 RNAi or the dominant-negative p53 mutant in MCF7 cells. Ectopic miR34a expression reduced cancer stem cell properties and increased sensitivity to doxorubicin treatment by directly targeting NOTCH1. Furthermore, tumors from nude mice treated with miR34a were significantly smaller compared with those of mice treated with control lentivirus.

Disease Class: Breast cancer [20]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Notch signaling pathway; Inhibition; hsa04330
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-34a expression modulated breast cancer cells response to ADR by targeting Notch1 and Notch signaling pathway.

Disease Class: Ewing sarcoma [21]

• Sensitive Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Sk-ES-1 cells; Bone; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: IOR/CAR cells; Sarcoma; Homo sapiens (Human); CVCL_H725
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Increased chemo-sensitivity and decreased aggressiveness of EWS cells after enforced expression of miR-34a.

Disease Class: Gastric cancer [13]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: KATO-3 cells; Gastric; Homo sapiens (Human); CVCL_0371
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Human gastric cancer kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor, miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth.

Epirubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [22]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Epirubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Regulation; hsa04310
• In Vitro Model: BIU87 cells; Bladder; Homo sapiens (Human); CVCL_6881
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-34a increased chemosensitivity in BIU87/ADR cells by inhibiting the TCF1/LEF1 axis.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [23]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: AlamarBlue assay
• Mechanism Description: A majority of NSCLC and other cancers previously not suited for erlotinib may prove sensitive to the drug when used in combination with a miR-34a-based therapy.

Disease Class: Head and neck cancer [24]

• Sensitive Disease: Head and neck cancer [ICD-11: 2D42.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: HN5 cells; Neck; Homo sapiens (Human); CVCL_8128
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Expression of the tumor suppressor miR-34a was reduced in HN5-ER cells and increasing its expression abrogated Axl expression and reversed erlotinib resistance.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAGE-A/p53 signaling pathway; Regulation; hsa04115
• In Vitro Model: HXO-Rb44 cells; Retina; Homo sapiens (Human); CVCL_D542
• In Vitro Model: SO-Rb50 cells; Retina; Homo sapiens (Human); CVCL_D543
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• In Vitro Model: Y79 cells; Retina; Homo sapiens (Human); CVCL_1893
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Freedom Evolyzer-2200 Enzyme-Linked Immunometric meter; Flow cytometry assay
• Mechanism Description: miR-34a may function as a tumor suppressor for RB by targeting MAGE-A and upregulating p53 expression to enhance cell apoptosis and chemosensitivity (Carboplatin; Etoposide; Adriamycin; vincristine).

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [25]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: DLD-1/5FU cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue dye exclusion assay
• Mechanism Description: The ectopic expression of miR-34a in the 5-FU-resistant cells inhibited growth, as in the parental cells, and attenuated the resistance to 5-FU through the down-regulation of Sirt1 and E2F3.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [26]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: LDHA was shown to be a direct target of miR 34a. Overexpression of miR 34a reduced the expression of LDHA, probably through binding to the 3' untranslated region, leading to the re sensitization of 5 FU resistant cancer cells to 5 FU. Additionally, overexpression of LDHA rendered colon cancer cells resistant to 5 FU, suggesting that the miR 34a induced sensitization to 5 FU is mediated through the inhibition of LDHA. The current study showed that miR 34a is involved in sensitivity to 5 FU in part through its effects on LDHA expression.

Disease Class: Colorectal cancer [27]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: A real-time cell analyzer assay
• Mechanism Description: c-KIT was shown to mediate chemo-resistance (kike 5-FU) in ovarian tumor initiating cells, miR-34a inhibits Erk signaling and colony formation by down-regulation of c-kit, miR-34a can inhibit this effect via down-regulation of c-kit and therefore sensitize cells to chemotherapeutic treatment.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [28]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HGF/ MET signaling pathway; Inhibition; hsa04151
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: MRC-5 cells; Lung; Homo sapiens (Human); CVCL_0440
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-8 assay; Flow cytometry assay
• Mechanism Description: In the HGF-induced gefitinib-resistant cell model, the exposure of miR-34a plus gefitinib efficiently inhibited the phosphorylation of MET, EGFR, Akt and ERk, and induced cell death, and apoptosis. In the presence of HGF, although EGFR was successfully inhibited by gefitinib monotherapy, the downstream pathways (PI3k/Akt and ERk pathway) were nevertheless activated by MET activation. Through addition of miR-34a to these cells, both MET and EGFR were successfully inhibited and subsequently the downstream pathways were blocked. However, the inhibitory effect of miR-34a on of MET and downstream pathways was lower than that for the MET-TkI. These results suggested that the combination of miR-34a and gefitinib was able to partially inhibit downstream pathways activation though inhibition of MET and EGFR activation in EGFR mutant NSCLC cells, though this effect was lower than what has been observed for MET-TkI.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [29]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [30]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Slug/PUMA signaling pathway; Regulation; hsa04390
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow Cytometric Analysis, MTT assay; TUNEL staining
• Mechanism Description: miR34 increases in vitro PANC-1 cell sensitivity to gemcitabine via targeting Slug/PUMA. miR34 enhances sensitization against gemcitabine-mediated apoptosis through the down-regulation of Slug expression, and up-regulation of Slug-dependent PUMA expression.

Disease Class: Gastric cancer [13]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: KATO-3 cells; Gastric; Homo sapiens (Human); CVCL_0371
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Human gastric cancer kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor, miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth.

Mitomycin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Medulloblastoma [12]

• Sensitive Disease: Medulloblastoma [ICD-11: 2A00.10]
• Sensitive Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: UW228 cells; Brain; Homo sapiens (Human); CVCL_8585
• In Vitro Model: R262 cells; Bone marrow; Homo sapiens (Human); CVCL_VU83
• In Vitro Model: R300 cells; Bone marrow; Homo sapiens (Human); CVCL_VU84
• In Vitro Model: UW426 cells; Bone marrow; Homo sapiens (Human); CVCL_DH82
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The repression of MAGE-A by miR-34a results in increased expression of p53 thus lead to resistance.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [31]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: WST-1 assay; Flow cytometry assay
• Mechanism Description: miR-34a positively regulates OAZ2 transcription by directly targeting its 3UTR and OAZ2 Overexpression Effectively Rescues the Chemosensitivity Impaired by miR-34a Deficiency.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [32]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR34a/PD-L1 signaling pathway; Regulation; hsa05206
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: U87-P cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V/PI apoptosis assay; Cell cycle assay; MTT assay
• Mechanism Description: miR34a attenuates glioma cells progression and chemoresistance via targeting PD-L1.

Disease Class: Prostate cancer [33]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Notch1 signaling pathway; Inhibition; hsa04330
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: microRNA-34a Attenuates Paclitaxel Resistance in Prostate Cancer Cells via Direct Suppression of JAG1/Notch1 Axis.

Disease Class: Breast cancer [34]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Notch1 signaling pathway; Inhibition; hsa04330
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-34a negatively regulated cell proliferation, migration, and invasion and breast cancer stem cell propagation by downregulating Notch1. The expression of miR-34a was negatively correlated with tumor stages, metastasis, and Notch1 expression in breast cancer tissues. Furthermore, overexpression of miR-34a increased chemosensitivity of breast cancer cells to paclitaxel (PTX) by downregulating the Notch1 pathway. Mammosphere formation and expression of the stemness factor ALDH1 were also reduced in the cells treated with miR-34a and PTX compared to those treated with PTX alone. miR-34a inhibited breast cancer stemness and increased the chemosensitivity to PTX partially by downregulating the Notch1 pathway, suggesting that miR-34a/Notch1 play an important role in regulating breast cancer stem cells.

Disease Class: Prostate cancer [35]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Trypan blue dye exclusion assay
• Mechanism Description: SIRT1 plays crucial roles in various cellular processes including cell survival under genotoxic and oxidative stresses. Bcl2I is an anti-apoptotic factor. In PC3PR cells, reduced expression of miR-34a confers paclitaxel resistance via up-regulating SIRT1 and Bcl2 expression.

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [36]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HL-7702 cells; Liver; Homo sapiens (Human); CVCL_6926
• In Vitro Model: MHCC97-H cells; Liver; Homo sapiens (Human); CVCL_4972
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The restoration of miR-34a reduced cell viability, promoted cell apoptosis and potentiated sorafenib-induced apoptosis and toxicity in HCC cell lines by inhibiting Bcl-2 expression.

Vemurafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [37]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Vemurafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PLX4032-resistant cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: Western blot analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: CCL2 and miR-125b, miR-34a and miR-100 are potential targets for overcoming the miR-34a and miR-100 are potential targets for overcoming the resistance to BRAFi in melanoma.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: MAGE-A/p53 signaling pathway; Regulation; hsa04115
• In Vitro Model: HXO-Rb44 cells; Retina; Homo sapiens (Human); CVCL_D542
• In Vitro Model: SO-Rb50 cells; Retina; Homo sapiens (Human); CVCL_D543
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• In Vitro Model: Y79 cells; Retina; Homo sapiens (Human); CVCL_1893
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Freedom Evolyzer-2200 Enzyme-Linked Immunometric meter; Flow cytometry assay
• Mechanism Description: miR-34a may function as a tumor suppressor for RB by targeting MAGE-A and upregulating p53 expression to enhance cell apoptosis and chemosensitivity (Carboplatin; Etoposide; Adriamycin; vincristine).

Disease Class: Ewing sarcoma [21]

• Sensitive Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: Sk-ES-1 cells; Bone; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: IOR/CAR cells; Sarcoma; Homo sapiens (Human); CVCL_H725
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Increased chemo-sensitivity and decreased aggressiveness of EWS cells after enforced expression of miR-34a.

Clinical Trial Drug(s) 3 drug(s) in total

Camptothecin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [38]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Camptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: PrEC cells; Prostate; Homo sapiens (Human); CVCL_0061
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Trypan blue dye exclusion assay
• Mechanism Description: Inhibition of the SIRT1 activity or expression resulted in attenuation of cell proliferation and chemoresistance in PC3 and DU145 cells. Ectopic expression of miR-34a decreased the SIRT1 mRNA and protein levels as well as protein levels of known direct target genes. Ectopic miR-34a expression resulted in cell cycle arrest and growth inhibition and attenuated chemoresistance to anticancer drug camptothecin by inducing apoptosis.

Genistein

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [39]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Genistein
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Dual-luciferase reporter assays
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Knockdown (siRNA) of HOTAIR decreased PCa cell proliferation, migration and invasion and induced apoptosis and cell cycle arrest. miR-34a was also up-regulated by genistein and may directly target HOTAIR in both PC3 and DU145 PCa cells.

Luteolin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [40]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Luteolin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53/p21 /MAPK/ERK signaling pathway; Regulation; hsa04115
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR34a, as a suppressor, enhance the susceptibility of gastric cancer cell to luteolin by directly targeting Hk1. miR34a overexpression could inhibit GC cells and induce G1 phase arrest via p53/p21 and MAPk /ERk pathways.

References

• Ref 1: miR 34a regulates the chemosensitivity of retinoblastoma cells via modulation of MAGE A/p53 signaling. Int J Oncol. 2019 Jan;54(1):177-187. doi: 10.3892/ijo.2018.4613. Epub 2018 Oct 31.
• Ref 2: LincHOTAIR epigenetically silences miR34a by binding to PRC2 to promote the epithelial-to-mesenchymal transition in human gastric cancer. Cell Death Dis. 2015 Jul 2;6(7):e1802. doi: 10.1038/cddis.2015.150.
• Ref 3: Knockdown of long non-coding RNA HOTAIR inhibits cisplatin resistance of gastric cancer cells through inhibiting the PI3K/Akt and Wnt/Beta-catenin signaling pathways by up-regulating miR-34a. Int J Biol Macromol. 2018 Feb;107(Pt B):2620-2629. doi: 10.1016/j.ijbiomac.2017.10.154. Epub 2017 Oct 26.
• Ref 4: Upregulation of microRNA-34a enhances the DDP sensitivity of gastric cancer cells by modulating proliferation and apoptosis via targeting MET. Oncol Rep. 2016 Oct;36(4):2391-7. doi: 10.3892/or.2016.5016. Epub 2016 Aug 11.
• Ref 5: miR-34a increases cisplatin sensitivity of osteosarcoma cells in vitro through up-regulation of c-Myc and Bim signal. Cancer Biomark. 2017 Dec 12;21(1):135-144. doi: 10.3233/CBM-170452.
• Ref 6: miR-34a sensitizes lung cancer cells to cisplatin via p53/miR-34a/MYCN axis. Biochem Biophys Res Commun. 2017 Jan 1;482(1):22-27. doi: 10.1016/j.bbrc.2016.11.037. Epub 2016 Nov 9.
• Ref 7: miRNA-34a decreases ovarian cancer cell proliferation and chemoresistance by targeting HDAC1. Biochem Cell Biol. 2018 Oct;96(5):663-671. doi: 10.1139/bcb-2018-0031. Epub 2018 Mar 21.
• Ref 8: Cisplatin-induced epigenetic activation of miR-34a sensitizes bladder cancer cells to chemotherapy. Mol Cancer. 2014 Jan 15;13:8. doi: 10.1186/1476-4598-13-8.
• Ref 9: miR-34a regulates cisplatin-induce gastric cancer cell death by modulating PI3K/AKT/survivin pathway. Tumour Biol. 2014 Feb;35(2):1287-95. doi: 10.1007/s13277-013-1171-7. Epub 2013 Sep 26.
• Ref 10: microRNA-34a sensitizes lung cancer cell lines to DDP treatment independent of p53 status. Cancer Biother Radiopharm. 2013 Feb;28(1):45-50. doi: 10.1089/cbr.2012.1218. Epub 2012 Oct 4.
• Ref 11: MiR-34a chemosensitizes bladder cancer cells to cisplatin treatment regardless of p53-Rb pathway status. Int J Cancer. 2012 Jun 1;130(11):2526-38. doi: 10.1002/ijc.26256. Epub 2011 Dec 2.
• Ref 12: miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75. doi: 10.1093/neuonc/noq179. Epub 2010 Dec 22.
• Ref 13: Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266. doi: 10.1186/1471-2407-8-266.
• Ref 14: miR-34a is an intracellular and exosomal predictive biomarker for response to docetaxel with clinical relevance to prostate cancer progression. Prostate. 2014 Sep;74(13):1320-34. doi: 10.1002/pros.22848. Epub 2014 Jul 22.
• Ref 15: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 16: miR-27b and miR-34a enhance docetaxel sensitivity of prostate cancer cells through inhibiting epithelial-to-mesenchymal transition by targeting ZEB1. Biomed Pharmacother. 2018 Jan;97:736-744. doi: 10.1016/j.biopha.2017.10.163. Epub 2017 Nov 6.
• Ref 17: TUG1 confers Adriamycin resistance in acute myeloid leukemia by epigenetically suppressing miR-34a expression via EZH2. Biomed Pharmacother. 2019 Jan;109:1793-1801. doi: 10.1016/j.biopha.2018.11.003. Epub 2018 Nov 26.
• Ref 18: [miR-34a may regulate sensitivity of breast cancer cells to adriamycin via targeting Notch1]. Zhonghua Zhong Liu Za Zhi. 2014 Dec;36(12):892-6.
• Ref 19: Targeting of miR34a-NOTCH1 axis reduced breast cancer stemness and chemoresistance. Cancer Res. 2014 Dec 15;74(24):7573-82. doi: 10.1158/0008-5472.CAN-14-1140. Epub 2014 Nov 3.
• Ref 20: MicroRNA-34a modulates chemosensitivity of breast cancer cells to adriamycin by targeting Notch1. Arch Med Res. 2012 Oct;43(7):514-21. doi: 10.1016/j.arcmed.2012.09.007. Epub 2012 Oct 16.
• Ref 21: miR-34a predicts survival of Ewing's sarcoma patients and directly influences cell chemo-sensitivity and malignancy. J Pathol. 2012 Apr;226(5):796-805. doi: 10.1002/path.3007.
• Ref 22: MicroRNA-34a Attenuates Metastasis and Chemoresistance of Bladder Cancer Cells by Targeting the TCF1/LEF1 Axis. Cell Physiol Biochem. 2018;48(1):87-98. doi: 10.1159/000491665. Epub 2018 Jul 12.
• Ref 23: In-depth analysis shows synergy between erlotinib and miR-34a. PLoS One. 2014 Feb 14;9(2):e89105. doi: 10.1371/journal.pone.0089105. eCollection 2014.
• Ref 24: Axl mediates acquired resistance of head and neck cancer cells to the epidermal growth factor receptor inhibitor erlotinib. Mol Cancer Ther. 2013 Nov;12(11):2541-58. doi: 10.1158/1535-7163.MCT-13-0170. Epub 2013 Sep 11.
• Ref 25: Dysregulation of microRNA-34a expression causes drug-resistance to 5-FU in human colon cancer DLD-1 cells. Cancer Lett. 2011 Jan 28;300(2):197-204. doi: 10.1016/j.canlet.2010.10.006. Epub 2010 Nov 9.
• Ref 26: Inhibition of lactate dehydrogenase A by microRNA-34a resensitizes colon cancer cells to 5-fluorouracil. Mol Med Rep. 2015 Jan;11(1):577-82. doi: 10.3892/mmr.2014.2726. Epub 2014 Oct 21.
• Ref 27: Repression of c-Kit by p53 is mediated by miR-34 and is associated with reduced chemoresistance, migration and stemness. Oncotarget. 2013 Sep;4(9):1399-415. doi: 10.18632/oncotarget.1202.
• Ref 28: MicroRNA-34a overcomes HGF-mediated gefitinib resistance in EGFR mutant lung cancer cells partly by targeting MET. Cancer Lett. 2014 Sep 1;351(2):265-71. doi: 10.1016/j.canlet.2014.06.010. Epub 2014 Jun 28.
• Ref 29: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 30: miR-34 increases in vitro PANC-1 cell sensitivity to gemcitabine via targeting Slug/PUMA. Cancer Biomark. 2018;21(4):755-762. doi: 10.3233/CBM-170289.
• Ref 31: miR-34a Regulates Multidrug Resistance via Positively Modulating OAZ2 Signaling in Colon Cancer Cells. J Immunol Res. 2018 Aug 2;2018:7498514. doi: 10.1155/2018/7498514. eCollection 2018.
• Ref 32: miR-34a attenuates glioma cells progression and chemoresistance via targeting PD-L1. Biotechnol Lett. 2017 Oct;39(10):1485-1492. doi: 10.1007/s10529-017-2397-z. Epub 2017 Jul 18.
• Ref 33: MicroRNA-34a Attenuates Paclitaxel Resistance in Prostate Cancer Cells via Direct Suppression of JAG1/Notch1 Axis. Cell Physiol Biochem. 2018;50(1):261-276. doi: 10.1159/000494004. Epub 2018 Oct 3.
• Ref 34: MicroRNA-34a suppresses the breast cancer stem cell-like characteristics by downregulating Notch1 pathway. Cancer Sci. 2015 Jun;106(6):700-8. doi: 10.1111/cas.12656.
• Ref 35: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 36: MicroRNA-34a targets Bcl-2 and sensitizes human hepatocellular carcinoma cells to sorafenib treatment. Technol Cancer Res Treat. 2014 Feb;13(1):77-86. doi: 10.7785/tcrt.2012.500364. Epub 2013 Jul 11.
• Ref 37: Overcoming melanoma resistance to vemurafenib by targeting CCL2-induced miR-34a, miR-100 and miR-125b. Oncotarget. 2016 Jan 26;7(4):4428-41. doi: 10.18632/oncotarget.6599.
• Ref 38: Effects of miR-34a on cell growth and chemoresistance in prostate cancer PC3 cells. Biochem Biophys Res Commun. 2008 Dec 5;377(1):114-9. doi: 10.1016/j.bbrc.2008.09.086. Epub 2008 Oct 1.
• Ref 39: Genistein inhibits prostate cancer cell growth by targeting miR-34a and oncogenic HOTAIR. PLoS One. 2013 Aug 1;8(8):e70372. doi: 10.1371/journal.pone.0070372. Print 2013.
• Ref 40: MiR-34a, as a suppressor, enhance the susceptibility of gastric cancer cell to luteolin by directly targeting HK1. Gene. 2018 Feb 20;644:56-65. doi: 10.1016/j.gene.2017.10.046. Epub 2017 Oct 18.