Disease Information

General Information of the Disease (ID: DIS00038)

• Name: Aspergillosis
• ICD: ICD-11: 1F20

Type(s) of Resistant Mechanism of This Disease

  ADTT: Aberration of the Drug's Therapeutic Target

  UAPP: Unusual Activation of Pro-survival Pathway

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Itraconazole

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Aberration of the Drug's Therapeutic Target (ADTT)

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54E
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: Itraconazole resistance has been tightly linked to cyp51A mutations in the codon for Gly54, resulting in five different amino substitutions (G54k, G54V, G54R, G54E, and G54W).

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [2]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.F46Y+p.M172V+p.N248T+p.D255E
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST broth dilution method assay
• Mechanism Description: Interestingly, the F46Y/M172V/N248T/D255E/E427k mutation, which has been reported to be associated with azole resistance (37), was detected in one clinical isolate from Shanghai and in one environmental isolate from Xinjiang, respectively.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [3]

• Resistant Disease: Aspergillosis [ICD-11: 1F20.0]
• Molecule Alteration: Missense mutation; p.I266N
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: Amino acid changes in CYP51a may contribute to Aspergillus fumigatus emerging itraconazole resistance.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [4]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G54E
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: A Point Mutation in the 14alpha-Sterol Demethylase Gene cyp51A Contributes to Itraconazole Resistance in Aspergillus fumigatus.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [5]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G54E+p.I266N
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: Amino acid changes in CYP51a may contribute to Aspergillus fumigatus emerging itraconazole resistance.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [6]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.M220L
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: PCR amplification and sequence analysis
• Experiment for Drug Resistance: NCCLS method M-27A with broth macrodilution techniques assay
• Mechanism Description: Five clinical isolates of Aspergillus fumigatus that exhibited similar patterns of reduced susceptibility to itraconazole and other triazole drugs were analyzed. Sequence analysis of genes (cyp51A and cyp51B) encoding the 14alpha-sterol demethylases revealed that all five strains harbored mutations in cyp51A resulting in the replacement of methionine at residue 220 by valine, lysine, or threonine. When the mutated cyp51A genes were introduced into an A. fumigatus wild-type strain, the transformants exhibited reduced susceptibility to all triazole agents, confirming that the mutations were responsible for the resistance phenotype.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [6]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.M220V
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: PCR amplification and sequence analysis
• Experiment for Drug Resistance: NCCLS method M-27A with broth macrodilution techniques assay
• Mechanism Description: Five clinical isolates of Aspergillus fumigatus that exhibited similar patterns of reduced susceptibility to itraconazole and other triazole drugs were analyzed. Sequence analysis of genes (cyp51A and cyp51B) encoding the 14alpha-sterol demethylases revealed that all five strains harbored mutations in cyp51A resulting in the replacement of methionine at residue 220 by valine, lysine, or threonine. When the mutated cyp51A genes were introduced into an A. fumigatus wild-type strain, the transformants exhibited reduced susceptibility to all triazole agents, confirming that the mutations were responsible for the resistance phenotype.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [6]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.M220T
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: PCR amplification and sequence analysis
• Experiment for Drug Resistance: NCCLS method M-27A with broth macrodilution techniques assay
• Mechanism Description: Five clinical isolates of Aspergillus fumigatus that exhibited similar patterns of reduced susceptibility to itraconazole and other triazole drugs were analyzed. Sequence analysis of genes (cyp51A and cyp51B) encoding the 14alpha-sterol demethylases revealed that all five strains harbored mutations in cyp51A resulting in the replacement of methionine at residue 220 by valine, lysine, or threonine. When the mutated cyp51A genes were introduced into an A. fumigatus wild-type strain, the transformants exhibited reduced susceptibility to all triazole agents, confirming that the mutations were responsible for the resistance phenotype.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [7]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.F219S
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Each single mutationad a measurable effect on the affinity of the target enzyme for specific azole derivatives.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [7]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G138S
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Each single mutationad a measurable effect on the affinity of the target enzyme for specific azole derivatives.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [7]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G138C
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Each single mutationad a measurable effect on the affinity of the target enzyme for specific azole derivatives.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [8]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Tandem repeat; TR53 (GAATCACGCGGTCCGATGTGTGCTGAGCCGAATGAAAGTTGTCTAATGTCTAGAATCACGCGGTCCGATGTGTGCTGAGCCGAATGAAAGTTGTCTAATGTCTA)
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: The azole-resistant A. fumigatus strains were detected tandem repeats (TRs) in the promoter region.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54V
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: Itraconazole resistance has been tightly linked to cyp51A mutations in the codon for Gly54, resulting in five different amino substitutions (G54k, G54V, G54R, G54E, and G54W).

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54K
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: The G54k amino acid change conferred cross-resistance to both itraconazole and posaconazole (26). The replacement of the wild-type chromosomal cyp51A allele by mutant allele bearing the G161A nucleotide change in codon 54 led to the acquisition of resistance to itraconazole de novo.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G161A
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: The G54k amino acid change conferred cross-resistance to both itraconazole and posaconazole (26). The replacement of the wild-type chromosomal cyp51A allele by mutant allele bearing the G161A nucleotide change in codon 54 led to the acquisition of resistance to itraconazole de novo.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54R
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: The G54k amino acid change conferred cross-resistance to both itraconazole and posaconazole (26). The replacement of the wild-type chromosomal cyp51A allele by mutant allele bearing the G161A nucleotide change in codon 54 led to the acquisition of resistance to itraconazole de novo.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54W
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: Itraconazole resistance has been tightly linked to cyp51A mutations in the codon for Gly54, resulting in five different amino substitutions (G54k, G54V, G54R, G54E, and G54W).

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.P216L
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.H147Y
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G434C
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y431C
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [10]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y121F+p.T289A+p.G448S+p.M172I
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain TR463; 746128
• Experiment for Molecule Alteration: PCR analysis
• Mechanism Description: In addition, to compare the susceptibility of TR463 with those of TR34 and TR46, the high resistance of TR463/Y121F/M172I/T289A/G448S was confirmed by MIC testing, displaying a pan-triazole-resistant phenotype to posaconazole, itraconazole, and voriconazole, indicating no in vitro activity of itraconazole and voriconazole (MIC, >16 mg/liter).

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [11]

• Resistant Disease: Chronic noninvasive aspergillosis [ICD-11: 1F20.4]
• Molecule Alteration: Missense mutation; p.M217I
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus terreus strain; 33178
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: In vivo emergence of Aspergillus terreus with reduced azole susceptibility which is related to Cyp51a M217I alteration.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [12]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G138C
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST broth dilution method assay
• Mechanism Description: Three different cyp51A mutations were found (G138C, Y431C, and G434C), of which the first two were demonstrated by heterologous expression in a hypersusceptible Saccharomyces cerevisiae strain to be at least partly responsible for elevated MICs.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [12]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y431C
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST broth dilution method assay
• Mechanism Description: Three different cyp51A mutations were found (G138C, Y431C, and G434C), of which the first two were demonstrated by heterologous expression in a hypersusceptible Saccharomyces cerevisiae strain to be at least partly responsible for elevated MICs.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54W
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: A. fumigatus is closely linked to amino acid substitutions in Cyp51A that replace Gly54

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [13]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.L98H
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: We have determined that a base change causing an amino acid substitution in Cyp51A (L98H) in combination with the duplication in tandem of a 34-bp sequence in the cyp51A promoter, which is responsible for the increased level of cyp51A gene expression, accounted for the resistant phenotype.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [14]

• Resistant Disease: Pulmonary aspergillosis [ICD-11: 1F20.7]
• Molecule Alteration: Missense mutation; p.M217I
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• Mechanism Description: Itraconazole acts by inhibiting the fungal cytochrome P-450 dependent enzyme lanosterol 14-alpha-demethylase.The development of itraconazole resistance in A. terreus which may be associated with M217I Cyp51A mutation.

Unusual Activation of Pro-survival Pathway (UAPP)

Key Molecule: Mitochondrial protoheme IX farnesyltransferase (COX10) [15]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.R243Q
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: NGS sequencing assay
• Experiment for Drug Resistance: HPLC analysis
• Mechanism Description: Through next-generation sequencing (NGS), we successfully identified a new mutation (R243Q substitution) conferring azole resistance in the putative A. fumigatus farnesyltransferase Cox10 (AfCox10) (AFUB_065450). High-performance liquid chromatography (HPLC) analysis verified that the decreased absorption of itraconazole in related Afcox10 mutants is the primary reason for itraconazole resistance.

Key Molecule: CCAAT-binding factor complex subunit (HAPE) [16]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.P88L
• Resistant Drug: Itraconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: Sanger sequencing assay
• Experiment for Drug Resistance: Growth kinetic assay
• Mechanism Description: Discovery of a HapE mutation that causes azole resistance in Aspergillus fumigatus through whole genome sequencing and sexual crossing.

Micafungin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Aberration of the Drug's Therapeutic Target (ADTT)

Key Molecule: D-glucan-1,3-beta--UDP glucosyltransferase (FKS1) [17]

• Resistant Disease: Chronic pulmonary aspergillosis [ICD-11: 1F20.5]
• Molecule Alteration: Missense mutation; p.F641S
• Resistant Drug: Micafungin
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Emergence of Echinocandin resistance due to a point mutation (F641S ) in the fks1 gene of Aspergillus fumigatus in a patient with chronic pulmonary aspergillosis.

Key Molecule: D-glucan-1,3-beta--UDP glucosyltransferase (FKS1) [17]

• Resistant Disease: Chronic pulmonary aspergillosis [ICD-11: 1F20.5]
• Molecule Alteration: Missense mutation; p.F675S
• Resistant Drug: Micafungin
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Emergence of Echinocandin resistance due to a point mutation (F675S ) in the fks1 gene of Aspergillus fumigatus in a patient with chronic pulmonary aspergillosis.

Posaconazole

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Aberration of the Drug's Therapeutic Target (ADTT)

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [2]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.F46Y+p.M172V+p.N248T+p.D255E
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST broth dilution method assay
• Mechanism Description: Interestingly, the F46Y/M172V/N248T/D255E/E427k mutation, which has been reported to be associated with azole resistance (37), was detected in one clinical isolate from Shanghai and in one environmental isolate from Xinjiang, respectively.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [18]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G54W
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: In the four isolates exhibiting moderate levels of POS resistance glycine 54 was mutated to either glutamate or arginine. In the mutant with a high level of POS resistance glycine 54 was mutated to tryptophan.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [7]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G138C
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Each single mutationad a measurable effect on the affinity of the target enzyme for specific azole derivatives.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54E
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: Itraconazole resistance has been tightly linked to cyp51A mutations in the codon for Gly54, resulting in five different amino substitutions (G54k, G54V, G54R, G54E, and G54W).

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54K
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: The G54k amino acid change conferred cross-resistance to both itraconazole and posaconazole (26). The replacement of the wild-type chromosomal cyp51A allele by mutant allele bearing the G161A nucleotide change in codon 54 led to the acquisition of resistance to itraconazole de novo.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [19]

• Resistant Disease: Aspergillus niger infection [ICD-11: 1F20.3]
• Molecule Alteration: Missense mutation; p.R228Q
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus niger strain; 5061
• Experiment for Molecule Alteration: PCR amplification and sequence analysis
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: Amino acid changes in ERG11 may contribute to Candida albicans emerging posaconazole resistance.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.P216L
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G434C
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y431C
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [10]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y121F+p.T289A+p.G448S+p.M172I
• Resistant Drug: Posaconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain TR463; 746128
• Experiment for Molecule Alteration: PCR analysis
• Mechanism Description: In addition, to compare the susceptibility of TR463 with those of TR34 and TR46, the high resistance of TR463/Y121F/M172I/T289A/G448S was confirmed by MIC testing, displaying a pan-triazole-resistant phenotype to posaconazole, itraconazole, and voriconazole, indicating no in vitro activity of itraconazole and voriconazole (MIC, >16 mg/liter).

Voriconazole

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Aberration of the Drug's Therapeutic Target (ADTT)

Key Molecule: Sterol 14-alpha demethylase (CYP51C) [20]

• Resistant Disease: Aspergillus flavus infection [ICD-11: 1F20.1]
• Molecule Alteration: Missense mutation; p.Y319H
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus flavus strain; 5059
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: A novel Y319H substitution in CYP51C associated with azole resistance in Aspergillus flavus.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [7]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G138C
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: Each single mutationad a measurable effect on the affinity of the target enzyme for specific azole derivatives.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [21]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Missense mutation; p.G448S
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: Resistance to voriconazole due to a G448S substitution in Aspergillus fumigatus in a patient with cerebral aspergillosis.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [8]

• Resistant Disease: Aspergillus fumigatus infection [ICD-11: 1F20.2]
• Molecule Alteration: Tandem repeat; TR53 (GAATCACGCGGTCCGATGTGTGCTGAGCCGAATGAAAGTTGTCTAATGTCTAGAATCACGCGGTCCGATGTGTGCTGAGCCGAATGAAAGTTGTCTAATGTCTA)
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: The azole-resistant A. fumigatus strains were detected tandem repeats (TRs) in the promoter region.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [1]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G54R
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain RIT; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: NCCLS M38-P microdilution methodology assay
• Mechanism Description: Itraconazole resistance has been tightly linked to cyp51A mutations in the codon for Gly54, resulting in five different amino substitutions (G54k, G54V, G54R, G54E, and G54W).

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.H147Y
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.G434C
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [9]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y431C
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain; 746128
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: EUCAST method assay
• Mechanism Description: Four novel mutations were found (H147Y, P216L, Y431C, and G434C). The isolate bearing the P216L mutation was resistant to itraconazole and posaconazole, whereas the isolates with Y431C and G434C showed pan-azole resistance phenotypes.

Key Molecule: Sterol 14-alpha demethylase cyp51A (CYP51A) [10]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.Y121F+p.T289A+p.G448S+p.M172I
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus fumigatus strain TR463; 746128
• Experiment for Molecule Alteration: PCR analysis
• Mechanism Description: In addition, to compare the susceptibility of TR463 with those of TR34 and TR46, the high resistance of TR463/Y121F/M172I/T289A/G448S was confirmed by MIC testing, displaying a pan-triazole-resistant phenotype to posaconazole, itraconazole, and voriconazole, indicating no in vitro activity of itraconazole and voriconazole (MIC, >16 mg/liter).

Key Molecule: Sterol 14-alpha demethylase (CYP51C) [22]

• Resistant Disease: Invasive aspergillosis [ICD-11: 1F20.6]
• Molecule Alteration: Missense mutation; p.T788G
• Resistant Drug: Voriconazole
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Aspergillus flavus strain; 5059
• Experiment for Molecule Alteration: DNA sequencing assay
• Experiment for Drug Resistance: Broth microdilution method assay
• Mechanism Description: The T788G mutation in the cyp51C gene confers voriconazole resistance in aspergillus flavus causing aspergillosis.

References

• Ref 1: Rapid, high-throughput, multiplex, real-time PCR for identification of mutations in the cyp51A gene of Aspergillus fumigatus that confer resistance to itraconazole. J Clin Microbiol. 2005 Jan;43(1):214-22. doi: 10.1128/JCM.43.1.214-222.2005.
• Ref 2: Epidemiology and Molecular Characterizations of Azole Resistance in Clinical and Environmental Aspergillus fumigatus Isolates from China. Antimicrob Agents Chemother. 2016 Sep 23;60(10):5878-84. doi: 10.1128/AAC.01005-16. Print 2016 Oct.
• Ref 3: Correlation between triazole treatment history and susceptibility in clinically isolated Aspergillus fumigatus. Antimicrob Agents Chemother. 2012 Sep;56(9):4870-5. doi: 10.1128/AAC.00514-12. Epub 2012 Jul 2.
• Ref 4: A point mutation in the 14alpha-sterol demethylase gene cyp51A contributes to itraconazole resistance in Aspergillus fumigatus. Antimicrob Agents Chemother. 2003 Mar;47(3):1120-4. doi: 10.1128/AAC.47.3.1120-1124.2003.
• Ref 5: Antifungal susceptibilities of Aspergillus fumigatus clinical isolates obtained in Nagasaki, Japan. Antimicrob Agents Chemother. 2012 Jan;56(1):584-7. doi: 10.1128/AAC.05394-11. Epub 2011 Oct 24.
• Ref 6: Substitutions at methionine 220 in the 14alpha-sterol demethylase (Cyp51A) of Aspergillus fumigatus are responsible for resistance in vitro to azole antifungal drugs. Antimicrob Agents Chemother. 2004 Jul;48(7):2747-50. doi: 10.1128/AAC.48.7.2747-2750.2004.
• Ref 7: Proposal for a unified nomenclature for target-site mutations associated with resistance to fungicides. Pest Manag Sci. 2016 Aug;72(8):1449-59. doi: 10.1002/ps.4301. Epub 2016 Jun 16.
• Ref 8: Development and Validation of a High-Resolution Melting Assay To Detect Azole Resistance in Aspergillus fumigatus. Antimicrob Agents Chemother. 2017 Nov 22;61(12):e01083-17. doi: 10.1128/AAC.01083-17. Print 2017 Dec.
• Ref 9: Frequency and evolution of Azole resistance in Aspergillus fumigatus associated with treatment failure. Emerg Infect Dis. 2009 Jul;15(7):1068-76. doi: 10.3201/eid1507.090043.
• Ref 10: A Novel Environmental Azole Resistance Mutation in Aspergillus fumigatus and a Possible Role of Sexual Reproduction in Its Emergence. mBio. 2017 Jun 27;8(3):e00791-17. doi: 10.1128/mBio.00791-17.
• Ref 11: In vivo emergence of Aspergillus terreus with reduced azole susceptibility and a Cyp51a M217I alteration. J Infect Dis. 2012 Sep 15;206(6):981-5. doi: 10.1093/infdis/jis442. Epub 2012 Jul 10.
• Ref 12: Interrogation of related clinical pan-azole-resistant Aspergillus fumigatus strains: G138C, Y431C, and G434C single nucleotide polymorphisms in cyp51A, upregulation of cyp51A, and integration and activation of transposon Atf1 in the cyp51A promoter. Antimicrob Agents Chemother. 2011 Nov;55(11):5113-21. doi: 10.1128/AAC.00517-11. Epub 2011 Aug 29.
• Ref 13: A new Aspergillus fumigatus resistance mechanism conferring in vitro cross-resistance to azole antifungals involves a combination of cyp51A alterations. Antimicrob Agents Chemother. 2007 Jun;51(6):1897-904. doi: 10.1128/AAC.01092-06. Epub 2007 Mar 19.
• Ref 14: Resistance mechanism and proteins in Aspergillus species against antifungal agents .Mycology. 2019 Feb 6;10(3):151-165. doi: 10.1080/21501203.2019.1574927. eCollection 2019. 10.1080/21501203.2019.1574927
• Ref 15: Screening and Characterization of a Non-cyp51A Mutation in an Aspergillus fumigatus cox10 Strain Conferring Azole Resistance. Antimicrob Agents Chemother. 2016 Dec 27;61(1):e02101-16. doi: 10.1128/AAC.02101-16. Print 2017 Jan.
• Ref 16: Discovery of a HapE mutation that causes azole resistance in Aspergillus fumigatus through whole genome sequencing and sexual crossing. PLoS One. 2012;7(11):e50034. doi: 10.1371/journal.pone.0050034. Epub 2012 Nov 30.
• Ref 17: Emergence of Echinocandin Resistance Due to a Point Mutation in the fks1 Gene of Aspergillus fumigatus in a Patient with Chronic Pulmonary Aspergillosis. Antimicrob Agents Chemother. 2017 Nov 22;61(12):e01277-17. doi: 10.1128/AAC.01277-17. Print 2017 Dec.
• Ref 18: Mutations in Aspergillus fumigatus resulting in reduced susceptibility to posaconazole appear to be restricted to a single amino acid in the cytochrome P450 14alpha-demethylase. Antimicrob Agents Chemother. 2003 Feb;47(2):577-81. doi: 10.1128/AAC.47.2.577-581.2003.
• Ref 19: Species Distribution and In Vitro Azole Susceptibility of Aspergillus Section Nigri Isolates from Clinical and Environmental Settings. J Clin Microbiol. 2016 Sep;54(9):2365-72. doi: 10.1128/JCM.01075-16. Epub 2016 Jul 13.
• Ref 20: A Novel Y319H Substitution in CYP51C Associated with Azole Resistance in Aspergillus flavus. Antimicrob Agents Chemother. 2015 Oct;59(10):6615-9. doi: 10.1128/AAC.00637-15. Epub 2015 Jul 27.
• Ref 21: Resistance to voriconazole due to a G448S substitution in Aspergillus fumigatus in a patient with cerebral aspergillosis. J Clin Microbiol. 2012 Jul;50(7):2531-4. doi: 10.1128/JCM.00329-12. Epub 2012 May 9.
• Ref 22: The T788G mutation in the cyp51C gene confers voriconazole resistance in Aspergillus flavus causing aspergillosis. Antimicrob Agents Chemother. 2012 May;56(5):2598-603. doi: 10.1128/AAC.05477-11. Epub 2012 Feb 6.