Molecule Information

General Information of the Molecule (ID: Mol05704)
Name
hsa-miR-99b ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUG
GGUCCGUGUC
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model TOV21G cells Ovary Homo sapiens (Human) CVCL_3613
TOV112D cells Ovary Homo sapiens (Human) CVCL_3612
C13 cells Ovary Homo sapiens (Human) CVCL_0114
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration		 miRNA probe assay
Experiment for
Drug Resistance		 Cell proliferation assays
Mechanism Description MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [2]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
Experiment for
Drug Resistance		 CellTiter-Blue Cell Viability Assay (Promega)
Mechanism Description Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
RT4 cells Bladder Homo sapiens (Human) CVCL_0036
RT112 cells Bladder Homo sapiens (Human) CVCL_1670
Experiment for
Molecule Alteration		 Western blot; Microarray Analysis; qRT-PCR
Experiment for
Drug Resistance		 Proliferation Assay
Mechanism Description Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation p53 signaling Regulation N.A.
In Vitro Model TOV21G cells Ovary Homo sapiens (Human) CVCL_3613
TOV112D cells Ovary Homo sapiens (Human) CVCL_3612
C13 cells Ovary Homo sapiens (Human) CVCL_0114
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration		 miRNA probe assay
Experiment for
Drug Resistance		 Cell proliferation assays
Mechanism Description MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance		 Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration		 Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [6]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Hydroxycamptothecin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [7]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
 Disease Info 
Resistant Drug Hydroxycamptothecin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
SGC-7901 cells Gastric Homo sapiens (Human) CVCL_0520
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
AGS cells Gastric Homo sapiens (Human) CVCL_0139
Experiment for
Molecule Alteration		 MiRNA microarray profiling, qRT-PCR
Experiment for
Drug Resistance		 A sulforhodamine B (SRB) assay
Mechanism Description MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.
References
Ref 1 Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.
Ref 2 Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
Ref 3 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 4 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 5 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 6 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 7 MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.