Molecule Information

General Information of the Molecule (ID: Mol05213)

• Name: hsa-miR-486-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GCAUCCUGUACUGAGCUGCCCCGAGGCCCUUCAUGCUGCCCAGCUCGGGGCAGCUCAGUA
  CAGGAUAC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-486-1 is decreased

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [4]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vivo Model: NOD-SCID IL2-rgamma-null (NSG) mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Western blot; Luciferase reporter assay
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: In conclusion, our studies reveal a novel role for miR-486-5p in regulating normal hematopoiesis and of BCR-ABL-induced miR-486-5p overexpression in modulating CML progenitor growth, survival, and drug sensitivity.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 4: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.