Molecule Information

General Information of the Molecule (ID: Mol05208)

Name	hsa-miR-501 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	GCUCUUCCUCUCUAAUCCUUUGUCCCUGGGUGAGAGUGCUUUCUGAAUGCAAUGCACCCG GGCAAGGAUUCUGAGAGGGUGAGC Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	SGC-7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	5-FU cells	Colon	Homo sapiens (Human)	CVCL_1846
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Cisplatin

Click to Show/Hide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Neuroblastoma [ICD-11: 2A00.02]				[2]
Sensitive Disease	Neuroblastoma [ICD-11: 2A00.02]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	U251 cells	Brain	Homo sapiens (Human)	CVCL_0021
In Vivo Model	Glioma tissues model			Homo sapiens
Experiment for Molecule Alteration	RT-qPCR; Luciferase reporter assay
Experiment for Drug Resistance	Cell proliferation assay; In vitro invasion assays
Mechanism Description	miR-501-3p sensitizes glioma cells to cisplatin by targeting MYCN

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	SGC-7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	5-FU cells	Colon	Homo sapiens (Human)	CVCL_1846
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Sunitinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0]			[1]
Resistant Disease	Renal cell carcinoma [ICD-11: 2C90.0]		Disease Info
Resistant Drug	Sunitinib		Drug Info
Molecule Alteration	Expression	Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vivo Model	Advanced renal cell carcinoma patients		Homo sapiens
Experiment for Molecule Alteration	RT-PCR
Mechanism Description	Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Vincristine

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Vincristine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	SGC-7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	5-FU cells	Colon	Homo sapiens (Human)	CVCL_1846
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

References

Ref 1	VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 2	Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.