Molecule Information
General Information of the Molecule (ID: Mol01659)
| Name |
hsa-miR-146b-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 146b
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UGAGAACUGAAUUCCAUAGGCUG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Carboplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| hFOB1.19 cells | Fetal bone | Homo sapiens (Human) | CVCL_3708 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-146b-5p was highly expressed in human osteosarcoma tissues and an elevated expression of miR-146b-5p was observed in human osteosarcoma tissues after chemotherapy. Furthermore, it was shown that miR-146b-5p overexpression promoted migration and invasiveness. miR-146b-5p overexpression also increased resistance to chemotherapy. Moreover, knockdown of miR-146b-5p substantially inhibited migration and invasion of osteosarcoma cells as well as rendered them significantly more sensitive to chemotherapy. Results of western blot assay indicated that miR-146b-5p increased MMP-16 protein expression and showed a decrease of ZNRF3 protein. Whereas, IWR-1-endo, an inhibitor of Wnt/beta-catenin, suppressed the decrease in apoptosis of osteosarcoma cells caused by miR-146b-5p overexpression. These results indicated that miR-146b-5p promoted proliferation, migration and invasiveness. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| hFOB1.19 cells | Fetal bone | Homo sapiens (Human) | CVCL_3708 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-146b-5p was highly expressed in human osteosarcoma tissues and an elevated expression of miR-146b-5p was observed in human osteosarcoma tissues after chemotherapy. Furthermore, it was shown that miR-146b-5p overexpression promoted migration and invasiveness. miR-146b-5p overexpression also increased resistance to chemotherapy. Moreover, knockdown of miR-146b-5p substantially inhibited migration and invasion of osteosarcoma cells as well as rendered them significantly more sensitive to chemotherapy. Results of western blot assay indicated that miR-146b-5p increased MMP-16 protein expression and showed a decrease of ZNRF3 protein. Whereas, IWR-1-endo, an inhibitor of Wnt/beta-catenin, suppressed the decrease in apoptosis of osteosarcoma cells caused by miR-146b-5p overexpression. These results indicated that miR-146b-5p promoted proliferation, migration and invasiveness. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [3] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| hFOB1.19 cells | Fetal bone | Homo sapiens (Human) | CVCL_3708 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-146b-5p was highly expressed in human osteosarcoma tissues and an elevated expression of miR-146b-5p was observed in human osteosarcoma tissues after chemotherapy. Furthermore, it was shown that miR-146b-5p overexpression promoted migration and invasiveness. miR-146b-5p overexpression also increased resistance to chemotherapy. Moreover, knockdown of miR-146b-5p substantially inhibited migration and invasion of osteosarcoma cells as well as rendered them significantly more sensitive to chemotherapy. Results of western blot assay indicated that miR-146b-5p increased MMP-16 protein expression and showed a decrease of ZNRF3 protein. Whereas, IWR-1-endo, an inhibitor of Wnt/beta-catenin, suppressed the decrease in apoptosis of osteosarcoma cells caused by miR-146b-5p overexpression. These results indicated that miR-146b-5p promoted proliferation, migration and invasiveness. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Mitomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [5] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | AKT/NF-kappaB signaling pathway | Inhibition | hsa05135 | |
| In Vitro Model | U251-MG cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87-MG cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR 146b 5p suppresses glioblastoma cell resistance to temozolomide through targeting TRAF6. Overexpression of miR 146b 5p or TRAF6 knockdown significantly decreased the level of p AkT and p p65. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
