Molecule Information
General Information of the Molecule (ID: Mol01635)
Name |
hsa-miR-342-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 342
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCUCACACAGAAAUCGCACCCGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Triple-negative breast cancer with high expression of miR-342-3p is more sensitive to chemotherapy drugs, and miR-342-3p can regulate the chemotherapy sensitivity of breast cancer cell line MDA-MB-231 to paclitaxel and cisplatin. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Triple-negative breast cancer with high expression of miR-342-3p is more sensitive to chemotherapy drugs, and miR-342-3p can regulate the chemotherapy sensitivity of breast cancer cell line MDA-MB-231 to paclitaxel and cisplatin. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.