Molecule Information

General Information of the Molecule (ID: Mol01635)

Name	hsa-miR-342-3p ,Homo sapiens
Synonyms	microRNA 342 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UCUCACACAGAAAUCGCACCCGU Click to Show/Hide
Ensembl ID	ENSG00000199082
HGNC ID	HGNC:31778
Mature Accession	MIMAT0000753
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Triple-negative breast cancer with high expression of miR-342-3p is more sensitive to chemotherapy drugs, and miR-342-3p can regulate the chemotherapy sensitivity of breast cancer cell line MDA-MB-231 to paclitaxel and cisplatin.

Paclitaxel

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Triple-negative breast cancer with high expression of miR-342-3p is more sensitive to chemotherapy drugs, and miR-342-3p can regulate the chemotherapy sensitivity of breast cancer cell line MDA-MB-231 to paclitaxel and cisplatin.

References

Ref 1	[Effect of miR-342-3p on chemotherapy sensitivity in triple-negative breast cancer]. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2014 May;39(5):488-95. doi: 10.3969/j.issn.1672-7347.2014.05.009.