General Information of the Molecule (ID: Mol01509)
Name
hsa-mir-497 ,Homo sapiens
Synonyms
microRNA 497
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR497
Gene ID
574456
Location
chr17:7017911-7018022[-]
Sequence
CCACCCCGGUCCUGCUCCCGCCCCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCAC
GUCCAAACCACACUGUGGUGUUAGAGCGAGGGUGGGGGAGGCACCGCCGAGG
    Click to Show/Hide
Ensembl ID
ENSG00000284027
HGNC ID
HGNC:32088
Precursor Accession
MI0003138
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
11 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [1]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
Sensitive Drug Bortezomib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Activation hsa05200
Cell viability Inhibition hsa05200
In Vitro Model U266 cells Bone marrow Homo sapiens (Human) CVCL_0566
RPMI-8226 cells Peripheral blood Homo sapiens (Human) CVCL_0014
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description microRNA-497 inhibits multiple myeloma growth and increases susceptibility to bortezomib by targeting Bcl-2.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] [2]
Sensitive Disease Epidermoid carcinoma [ICD-11: 2C31.Z]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model KB-3-1 cells Lung Homo sapiens (Human) CVCL_2088
KB-CP.5 cells Lung Homo sapiens (Human) CVCL_IP04
KB-CP20 cells Lung Homo sapiens (Human) CVCL_IP06
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
MEK/ERK signaling pathway Inhibition hsa04011
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
COLO 205 cells Colon Homo sapiens (Human) CVCL_0218
HCT28 cells Colon Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description IGF1-R has an important role in mediating activation of the PI3k/Akt pathway, miR-497 inhibits PI3k/Akt signalling. Down-regulation of miR-497 is an important mechanism of upregulation of IGF1-R in CRC cells that contributes to malignancy of CRC.
Disease Class: Lung cancer [ICD-11: 2C25.5] [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [4]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [5]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Karpas-422 cells Peritoneal effusion Homo sapiens (Human) CVCL_1325
RI-1 cells Peritoneal effusion Homo sapiens (Human) CVCL_1885
U2932 cells Peritoneal effusion Homo sapiens (Human) CVCL_1896
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [6]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
FGF/FGFR signaling pathway Inhibition hsa01521
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-497 suppressed cells proliferation, decreased the percentage of S phase cells, re-sensitized cells to gemcitabine and erlotinib, and attenuated migration and invasion capacities. Furthermore, fibroblast growth factor 2 and fibroblast growth factor receptor 1 were confirmed as miR-497 targets. Overexpression of miR-497 inhibited tumor growth in vivo. Additionally, miR-497 expression was significantly downregulated in pancreatic cancer tissues compared with tumor-adjacent samples. Low expression of miR-497 was an independent adverse prognostic factor of pancreatic cancer. miR-497 plays a role in modulating the malignant phenotype and chemosensitivity of pancreatic cancer cells by directly inhibition of FGF2 and FGFR1 expression.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [7], [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
MAPK/ERK signaling pathway Inhibition hsa04010
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
SW1116 cells Colon Homo sapiens (Human) CVCL_0544
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miRNA-497 targeted Smurf1 in CRC cells and the Smurf1 expression level was dramatically increased in neoadjuvant therapy-resistant patients compared with treatment-sensitive patients. These results indicate that down-regulation of miRNA-497 in colorectal cancer may contribute to the resistance of CRC cells to 5-FU treatment. Thus, miRNA-497 has the potential to be a novel biomarker for predicting the neoadjuvant chemotherapy sensitivity in CRC patients.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [3]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
MEK/ERK signaling pathway Inhibition hsa04011
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
COLO 205 cells Colon Homo sapiens (Human) CVCL_0218
HCT28 cells Colon Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description IGF1-R has an important role in mediating activation of the PI3k/Akt pathway, miR-497 inhibits PI3k/Akt signalling. Down-regulation of miR-497 is an important mechanism of upregulation of IGF1-R in CRC cells that contributes to malignancy of CRC.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [6]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
FGF/FGFR signaling pathway Inhibition hsa01521
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-497 suppressed cells proliferation, decreased the percentage of S phase cells, re-sensitized cells to gemcitabine and erlotinib, and attenuated migration and invasion capacities. Furthermore, fibroblast growth factor 2 and fibroblast growth factor receptor 1 were confirmed as miR-497 targets. Overexpression of miR-497 inhibited tumor growth in vivo. Additionally, miR-497 expression was significantly downregulated in pancreatic cancer tissues compared with tumor-adjacent samples. Low expression of miR-497 was an independent adverse prognostic factor of pancreatic cancer. miR-497 plays a role in modulating the malignant phenotype and chemosensitivity of pancreatic cancer cells by directly inhibition of FGF2 and FGFR1 expression.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [9]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model IOSE386 cells Ovary Homo sapiens (Human) CVCL_E230
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
TUOC1 cells Ovary Homo sapiens (Human) CVCL_L700
OVCAR-3 cells Ascites Homo sapiens (Human) CVCL_0465
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
C13 cells Ovary Homo sapiens (Human) CVCL_0114
KK cells Ascites Homo sapiens (Human) CVCL_F844
KOC7C cells Pleural effusion Homo sapiens (Human) CVCL_5307
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Seventeen miRNAs were overexpressed in Taxol-resistant cells, including miR-663, miR-622, and HS_188
Rituximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [5]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Rituximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Karpas-422 cells Peritoneal effusion Homo sapiens (Human) CVCL_1325
RI-1 cells Peritoneal effusion Homo sapiens (Human) CVCL_1885
U2932 cells Peritoneal effusion Homo sapiens (Human) CVCL_1896
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [10]
Resistant Disease Glioma [ICD-11: 2A00.1]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation IGF1R/IRS1 signaling pathway Activation hsa04212
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
U138 cells Brain Homo sapiens (Human) CVCL_0020
HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
NHA cells Brain Homo sapiens (Human) N.A.
LN382 cells Brain Homo sapiens (Human) CVCL_3956
SF295 cells Brain Homo sapiens (Human) CVCL_1690
SHG-44 cells Brain Homo sapiens (Human) CVCL_6728
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Up-regulation of miR-497 confers resistance to temozolomide in human glioma cells by targeting mTOR/Bcl-2. The silencing of miR-497 decreased the protein levels of IGF1R/IRS1 pathway-related proteins, that is, IGF1R, IRS1, mTOR, and Bcl-2.
Disease Class: Glioma [ICD-11: 2A00.1] [11]
Resistant Disease Glioma [ICD-11: 2A00.1]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Ectopic overexpression of miR-497 promotes chemotherapy resistance in glioma cells by targeting PDCD4, a tumor suppressor that is involved in apoptosis. In contrast, the inhibition of miR-497 enhances apoptosis and increases the sensitivity of glioma cells to TMZ.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [12]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [5]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Karpas-422 cells Peritoneal effusion Homo sapiens (Human) CVCL_1325
RI-1 cells Peritoneal effusion Homo sapiens (Human) CVCL_1885
U2932 cells Peritoneal effusion Homo sapiens (Human) CVCL_1896
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.
Disease Class: Lung cancer [ICD-11: 2C25.5] [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [4]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.
References
Ref 1 MicroRNA-497 inhibits multiple myeloma growth and increases susceptibility to bortezomib by targeting Bcl-2. Int J Mol Med. 2019 Feb;43(2):1058-1066. doi: 10.3892/ijmm.2018.4019. Epub 2018 Dec 7.
Ref 2 Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
Ref 3 MicroRNA-497 targets insulin-like growth factor 1 receptor and has a tumour suppressive role in human colorectal cancer. Oncogene. 2013 Apr 11;32(15):1910-20. doi: 10.1038/onc.2012.214. Epub 2012 Jun 18.
Ref 4 miR-497 modulates multidrug resistance of human cancer cell lines by targeting BCL2. Med Oncol. 2012 Mar;29(1):384-91. doi: 10.1007/s12032-010-9797-4. Epub 2011 Jan 22.
Ref 5 miR-199a and miR-497 Are Associated with Better Overall Survival due to Increased Chemosensitivity in Diffuse Large B-Cell Lymphoma Patients. Int J Mol Sci. 2015 Aug 5;16(8):18077-95. doi: 10.3390/ijms160818077.
Ref 6 MiR-497 downregulation contributes to the malignancy of pancreatic cancer and associates with a poor prognosis. Oncotarget. 2014 Aug 30;5(16):6983-93. doi: 10.18632/oncotarget.2184.
Ref 7 miRNA-497 Enhances the Sensitivity of Colorectal Cancer Cells to Neoadjuvant Chemotherapeutic Drug. Curr Protein Pept Sci. 2015;16(4):310-5. doi: 10.2174/138920371604150429154142.
Ref 8 MicroRNA-497 inhibits tumor growth and increases chemosensitivity to 5-fluorouracil treatment by targeting KSR1. Oncotarget. 2016 Jan 19;7(3):2660-71. doi: 10.18632/oncotarget.6545.
Ref 9 Overcoming acquired BRAF inhibitor resistance in melanoma via targeted inhibition of Hsp90 with ganetespibMol Cancer Ther. 2014 Feb;13(2):353-63. doi: 10.1158/1535-7163.MCT-13-0481. Epub 2014 Jan 7.
Ref 10 Up-regulation of miR-497 confers resistance to temozolomide in human glioma cells by targeting mTOR/Bcl-2. Cancer Med. 2017 Feb;6(2):452-462. doi: 10.1002/cam4.987. Epub 2017 Jan 8.
Ref 11 Hypoxia-induced miR-497 decreases glioma cell sensitivity to TMZ by inhibiting apoptosis. FEBS Lett. 2014 Sep 17;588(18):3333-9. doi: 10.1016/j.febslet.2014.07.021. Epub 2014 Jul 29.
Ref 12 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.