Molecule Information
General Information of the Molecule (ID: Mol01509)
| Name |
hsa-mir-497
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 497
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR497
|
||||
| Gene ID | |||||
| Location |
chr17:7017911-7018022[-]
|
||||
| Sequence |
CCACCCCGGUCCUGCUCCCGCCCCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCAC
GUCCAAACCACACUGUGGUGUUAGAGCGAGGGUGGGGGAGGCACCGCCGAGG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [1] | |||
| Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 |
| RPMI-8226 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0014 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-497 inhibits multiple myeloma growth and increases susceptibility to bortezomib by targeting Bcl-2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] | [2] | |||
| Sensitive Disease | Epidermoid carcinoma [ICD-11: 2C31.Z] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | KB-3-1 cells | Lung | Homo sapiens (Human) | CVCL_2088 |
| KB-CP.5 cells | Lung | Homo sapiens (Human) | CVCL_IP04 | |
| KB-CP20 cells | Lung | Homo sapiens (Human) | CVCL_IP06 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1. | |||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| MEK/ERK signaling pathway | Inhibition | hsa04011 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| COLO 205 cells | Colon | Homo sapiens (Human) | CVCL_0218 | |
| HCT28 cells | Colon | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | IGF1-R has an important role in mediating activation of the PI3k/Akt pathway, miR-497 inhibits PI3k/Akt signalling. Down-regulation of miR-497 is an important mechanism of upregulation of IGF1-R in CRC cells that contributes to malignancy of CRC. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [4] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [5] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Karpas-422 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1325 | |
| RI-1 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1885 | |
| U2932 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1896 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [6] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Erlotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| FGF/FGFR signaling pathway | Inhibition | hsa01521 | ||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-497 suppressed cells proliferation, decreased the percentage of S phase cells, re-sensitized cells to gemcitabine and erlotinib, and attenuated migration and invasion capacities. Furthermore, fibroblast growth factor 2 and fibroblast growth factor receptor 1 were confirmed as miR-497 targets. Overexpression of miR-497 inhibited tumor growth in vivo. Additionally, miR-497 expression was significantly downregulated in pancreatic cancer tissues compared with tumor-adjacent samples. Low expression of miR-497 was an independent adverse prognostic factor of pancreatic cancer. miR-497 plays a role in modulating the malignant phenotype and chemosensitivity of pancreatic cancer cells by directly inhibition of FGF2 and FGFR1 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [7], [8] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| MAPK/ERK signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miRNA-497 targeted Smurf1 in CRC cells and the Smurf1 expression level was dramatically increased in neoadjuvant therapy-resistant patients compared with treatment-sensitive patients. These results indicate that down-regulation of miRNA-497 in colorectal cancer may contribute to the resistance of CRC cells to 5-FU treatment. Thus, miRNA-497 has the potential to be a novel biomarker for predicting the neoadjuvant chemotherapy sensitivity in CRC patients. | |||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| MEK/ERK signaling pathway | Inhibition | hsa04011 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| COLO 205 cells | Colon | Homo sapiens (Human) | CVCL_0218 | |
| HCT28 cells | Colon | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | IGF1-R has an important role in mediating activation of the PI3k/Akt pathway, miR-497 inhibits PI3k/Akt signalling. Down-regulation of miR-497 is an important mechanism of upregulation of IGF1-R in CRC cells that contributes to malignancy of CRC. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [6] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| FGF/FGFR signaling pathway | Inhibition | hsa01521 | ||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-497 suppressed cells proliferation, decreased the percentage of S phase cells, re-sensitized cells to gemcitabine and erlotinib, and attenuated migration and invasion capacities. Furthermore, fibroblast growth factor 2 and fibroblast growth factor receptor 1 were confirmed as miR-497 targets. Overexpression of miR-497 inhibited tumor growth in vivo. Additionally, miR-497 expression was significantly downregulated in pancreatic cancer tissues compared with tumor-adjacent samples. Low expression of miR-497 was an independent adverse prognostic factor of pancreatic cancer. miR-497 plays a role in modulating the malignant phenotype and chemosensitivity of pancreatic cancer cells by directly inhibition of FGF2 and FGFR1 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [5] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Rituximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Karpas-422 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1325 | |
| RI-1 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1885 | |
| U2932 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1896 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [9] | |||
| Resistant Disease | Glioma [ICD-11: 2A00.1] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | IGF1R/IRS1 signaling pathway | Activation | hsa04212 | |
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| U138 cells | Brain | Homo sapiens (Human) | CVCL_0020 | |
| HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 | |
| NHA cells | Brain | Homo sapiens (Human) | N.A. | |
| LN382 cells | Brain | Homo sapiens (Human) | CVCL_3956 | |
| SF295 cells | Brain | Homo sapiens (Human) | CVCL_1690 | |
| SHG-44 cells | Brain | Homo sapiens (Human) | CVCL_6728 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Up-regulation of miR-497 confers resistance to temozolomide in human glioma cells by targeting mTOR/Bcl-2. The silencing of miR-497 decreased the protein levels of IGF1R/IRS1 pathway-related proteins, that is, IGF1R, IRS1, mTOR, and Bcl-2. | |||
| Disease Class: Glioma [ICD-11: 2A00.1] | [10] | |||
| Resistant Disease | Glioma [ICD-11: 2A00.1] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Ectopic overexpression of miR-497 promotes chemotherapy resistance in glioma cells by targeting PDCD4, a tumor suppressor that is involved in apoptosis. In contrast, the inhibition of miR-497 enhances apoptosis and increases the sensitivity of glioma cells to TMZ. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [5] | |||
| Sensitive Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Karpas-422 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1325 | |
| RI-1 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1885 | |
| U2932 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_1896 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [4] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
