Molecule Information

General Information of the Molecule (ID: Mol01509)

• Name: hsa-mir-497 ,Homo sapiens
• Synonyms: microRNA 497
• Molecule Type: Precursor miRNA
• Gene Name: MIR497
• Gene ID: 574456
• Location: chr17:7017911-7018022[-]
• Sequence:
  CCACCCCGGUCCUGCUCCCGCCCCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCAC
  GUCCAAACCACACUGUGGUGUUAGAGCGAGGGUGGGGGAGGCACCGCCGAGG
• Ensembl ID: ENSG00000284027
• HGNC ID: HGNC:32088
• Precursor Accession: MI0003138

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Bortezomib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [1]

• Sensitive Disease: Multiple myeloma [ICD-11: 2A83.0]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: RPMI-8226 cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: microRNA-497 inhibits multiple myeloma growth and increases susceptibility to bortezomib by targeting Bcl-2.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epidermoid carcinoma [2]

• Sensitive Disease: Epidermoid carcinoma [ICD-11: 2C31.Z]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: KB-3-1 cells; Lung; Homo sapiens (Human); CVCL_2088
• In Vitro Model: KB-CP.5 cells; Lung; Homo sapiens (Human); CVCL_IP04
• In Vitro Model: KB-CP20 cells; Lung; Homo sapiens (Human); CVCL_IP06
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.

Disease Class: Colorectal cancer [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: MEK/ERK signaling pathway; Inhibition; hsa04011
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: COLO 205 cells; Colon; Homo sapiens (Human); CVCL_0218
• In Vitro Model: HCT28 cells; Colon; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: IGF1-R has an important role in mediating activation of the PI3k/Akt pathway, miR-497 inhibits PI3k/Akt signalling. Down-regulation of miR-497 is an important mechanism of upregulation of IGF1-R in CRC cells that contributes to malignancy of CRC.

Disease Class: Lung cancer [4]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [5]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• In Vitro Model: Karpas-422 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1325
• In Vitro Model: RI-1 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1885
• In Vitro Model: U2932 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1896
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [6]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: FGF/FGFR signaling pathway; Inhibition; hsa01521
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-497 suppressed cells proliferation, decreased the percentage of S phase cells, re-sensitized cells to gemcitabine and erlotinib, and attenuated migration and invasion capacities. Furthermore, fibroblast growth factor 2 and fibroblast growth factor receptor 1 were confirmed as miR-497 targets. Overexpression of miR-497 inhibited tumor growth in vivo. Additionally, miR-497 expression was significantly downregulated in pancreatic cancer tissues compared with tumor-adjacent samples. Low expression of miR-497 was an independent adverse prognostic factor of pancreatic cancer. miR-497 plays a role in modulating the malignant phenotype and chemosensitivity of pancreatic cancer cells by directly inhibition of FGF2 and FGFR1 expression.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [7], [8]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: MAPK/ERK signaling pathway; Inhibition; hsa04010
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miRNA-497 targeted Smurf1 in CRC cells and the Smurf1 expression level was dramatically increased in neoadjuvant therapy-resistant patients compared with treatment-sensitive patients. These results indicate that down-regulation of miRNA-497 in colorectal cancer may contribute to the resistance of CRC cells to 5-FU treatment. Thus, miRNA-497 has the potential to be a novel biomarker for predicting the neoadjuvant chemotherapy sensitivity in CRC patients.

Disease Class: Colorectal cancer [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: MEK/ERK signaling pathway; Inhibition; hsa04011
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: COLO 205 cells; Colon; Homo sapiens (Human); CVCL_0218
• In Vitro Model: HCT28 cells; Colon; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: IGF1-R has an important role in mediating activation of the PI3k/Akt pathway, miR-497 inhibits PI3k/Akt signalling. Down-regulation of miR-497 is an important mechanism of upregulation of IGF1-R in CRC cells that contributes to malignancy of CRC.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [6]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: FGF/FGFR signaling pathway; Inhibition; hsa01521
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-497 suppressed cells proliferation, decreased the percentage of S phase cells, re-sensitized cells to gemcitabine and erlotinib, and attenuated migration and invasion capacities. Furthermore, fibroblast growth factor 2 and fibroblast growth factor receptor 1 were confirmed as miR-497 targets. Overexpression of miR-497 inhibited tumor growth in vivo. Additionally, miR-497 expression was significantly downregulated in pancreatic cancer tissues compared with tumor-adjacent samples. Low expression of miR-497 was an independent adverse prognostic factor of pancreatic cancer. miR-497 plays a role in modulating the malignant phenotype and chemosensitivity of pancreatic cancer cells by directly inhibition of FGF2 and FGFR1 expression.

Rituximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [5]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Rituximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• In Vitro Model: Karpas-422 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1325
• In Vitro Model: RI-1 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1885
• In Vitro Model: U2932 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1896
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [9]

• Resistant Disease: Glioma [ICD-11: 2A00.1]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: IGF1R/IRS1 signaling pathway; Activation; hsa04212
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: U138 cells; Brain; Homo sapiens (Human); CVCL_0020
• In Vitro Model: HEK293 cells; Kidney; Homo sapiens (Human); CVCL_0045
• In Vitro Model: NHA cells; Brain; Homo sapiens (Human); N.A.
• In Vitro Model: LN382 cells; Brain; Homo sapiens (Human); CVCL_3956
• In Vitro Model: SF295 cells; Brain; Homo sapiens (Human); CVCL_1690
• In Vitro Model: SHG-44 cells; Brain; Homo sapiens (Human); CVCL_6728
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Up-regulation of miR-497 confers resistance to temozolomide in human glioma cells by targeting mTOR/Bcl-2. The silencing of miR-497 decreased the protein levels of IGF1R/IRS1 pathway-related proteins, that is, IGF1R, IRS1, mTOR, and Bcl-2.

Disease Class: Glioma [10]

• Resistant Disease: Glioma [ICD-11: 2A00.1]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Ectopic overexpression of miR-497 promotes chemotherapy resistance in glioma cells by targeting PDCD4, a tumor suppressor that is involved in apoptosis. In contrast, the inhibition of miR-497 enhances apoptosis and increases the sensitivity of glioma cells to TMZ.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [5]

• Sensitive Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• In Vitro Model: Karpas-422 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1325
• In Vitro Model: RI-1 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1885
• In Vitro Model: U2932 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_1896
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.

Disease Class: Lung cancer [4]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.

Disease Class: Gastric cancer [4]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Enforced miR-497 expression reduced BCL2 protein level and sensitized SGC7901/VCR and A549/CDDP cells to VCR-induced and CDDP-induced apoptosis, has-miR-497 could play a role in both gastric and lung cancer cell lines at least in part by modulation of apoptosis via targeting BCL2.

References

• Ref 1: MicroRNA-497 inhibits multiple myeloma growth and increases susceptibility to bortezomib by targeting Bcl-2. Int J Mol Med. 2019 Feb;43(2):1058-1066. doi: 10.3892/ijmm.2018.4019. Epub 2018 Dec 7.
• Ref 2: Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
• Ref 3: MicroRNA-497 targets insulin-like growth factor 1 receptor and has a tumour suppressive role in human colorectal cancer. Oncogene. 2013 Apr 11;32(15):1910-20. doi: 10.1038/onc.2012.214. Epub 2012 Jun 18.
• Ref 4: miR-497 modulates multidrug resistance of human cancer cell lines by targeting BCL2. Med Oncol. 2012 Mar;29(1):384-91. doi: 10.1007/s12032-010-9797-4. Epub 2011 Jan 22.
• Ref 5: miR-199a and miR-497 Are Associated with Better Overall Survival due to Increased Chemosensitivity in Diffuse Large B-Cell Lymphoma Patients. Int J Mol Sci. 2015 Aug 5;16(8):18077-95. doi: 10.3390/ijms160818077.
• Ref 6: MiR-497 downregulation contributes to the malignancy of pancreatic cancer and associates with a poor prognosis. Oncotarget. 2014 Aug 30;5(16):6983-93. doi: 10.18632/oncotarget.2184.
• Ref 7: miRNA-497 Enhances the Sensitivity of Colorectal Cancer Cells to Neoadjuvant Chemotherapeutic Drug. Curr Protein Pept Sci. 2015;16(4):310-5. doi: 10.2174/138920371604150429154142.
• Ref 8: MicroRNA-497 inhibits tumor growth and increases chemosensitivity to 5-fluorouracil treatment by targeting KSR1. Oncotarget. 2016 Jan 19;7(3):2660-71. doi: 10.18632/oncotarget.6545.
• Ref 9: Up-regulation of miR-497 confers resistance to temozolomide in human glioma cells by targeting mTOR/Bcl-2. Cancer Med. 2017 Feb;6(2):452-462. doi: 10.1002/cam4.987. Epub 2017 Jan 8.
• Ref 10: Hypoxia-induced miR-497 decreases glioma cell sensitivity to TMZ by inhibiting apoptosis. FEBS Lett. 2014 Sep 17;588(18):3333-9. doi: 10.1016/j.febslet.2014.07.021. Epub 2014 Jul 29.