General Information of the Molecule (ID: Mol01506)
Name
hsa-mir-494 ,Homo sapiens
Synonyms
microRNA 494
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR494
Gene ID
574452
Location
chr14:101029634-101029714[+]
Sequence
GAUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGAAACAUACACG
GGAAACCUCUUUUUUAGUAUC
    Click to Show/Hide
Ensembl ID
ENSG00000194717
HGNC ID
HGNC:32084
Precursor Accession
MI0003134
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [1]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation BCL2 signaling pathway Activation hsa04210
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
H446 cells Lung Homo sapiens (Human) CVCL_1562
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Knockdown of SCGN led to significantly increasing of chemosensitivity, which is similar to those induced by miR-494 mimics, and ectopic expression of SCGN could rescue the suppressive effect of miR-494.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell colony Activation hsa05200
Cell viability Activation hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description microRNA 494 increases chemosensitivity to doxorubicin in gastric cancer cells by targeting phosphodiesterases 4D.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [1]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation BCL2 signaling pathway Activation hsa04210
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
H446 cells Lung Homo sapiens (Human) CVCL_1562
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Knockdown of SCGN led to significantly increasing of chemosensitivity, which is similar to those induced by miR-494 mimics, and ectopic expression of SCGN could rescue the suppressive effect of miR-494.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [1]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation BCL2 signaling pathway Activation hsa04210
Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
H446 cells Lung Homo sapiens (Human) CVCL_1562
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Knockdown of SCGN led to significantly increasing of chemosensitivity, which is similar to those induced by miR-494 mimics, and ectopic expression of SCGN could rescue the suppressive effect of miR-494.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [3]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation 5-Fu catabolic signaling pathway Regulation N.A.
Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
HCT15 cells Colon Homo sapiens (Human) CVCL_0292
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-494 also negatively regulated endogenous DPYD expression in SW480 cells. Overexpression or knockdown of DPYD could attenuate miR-494 mediated 5-Fu sensitivity regulation, suggesting the dependence of DPYD regulation in miR-494 activity. miR-494 inhibited SW480/5-Fu derived xenograft tumors growth in vivo at present of 5-Fu.
Lapatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [4]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Lapatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model YCC1 cells Gastric Homo sapiens (Human) CVCL_9646
YCC1-F cells Gastric Homo sapiens (Human) CVCL_9646
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR 494 inhibited the CIC phenotype and reversed resistance to lapatinib by inhibiting FGFR2 in HER2 positive gastric cancer.
Mitoxantrone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [5]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Sensitive Drug Mitoxantrone
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
U937 cells Blood Homo sapiens (Human) CVCL_0007
KG1a cells Pleural effusion Homo sapiens (Human) CVCL_1824
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description microRNA-494 activation suppresses bone marrow stromal cell-mediated drug resistance in acute myeloid leukemia cells.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [6]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PTEN/AKT pathway Regulation N.A.
In Vitro Model HT-29 cells Colon Homo sapiens (Human) CVCL_0320
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description MiR-494-3p expression in oxaliplatin-resistant HT-29 cells was much higher than that in parental HT-29 cells, accompanied by increased levels of MRP, P-gp, and AKT phosphorylation (p-AKT), and decreased phosphatase and tensin homolog (PTEN) (p < 0.001). The miR-494-3p mimic suppressed oxaliplatin-induced parental HT-29 cell apoptosis, while miR-494-3p inhibitor promoted oxaliplatin-resistant HT-29 cell apoptosis and decreased the levels of p-AKT, MRP and P-gp, while upregulating PTEN (p < 0.001). Furthermore, AKT inhibitor had similar effects as miR-494-3p inhibitor (p < 0.001). Experiments using nude mice demonstrated that inhibition of miR-494-3p accentuated the sensitivity of oxaliplatin-resistant HT-29 cells to oxaliplatin (p < 0.05).
Silibinin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [7]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Silibinin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
TUNEL cell apoptosis assay; XTT cell proliferation assay; MTT cell proliferation assay; Colony formation assay
Mechanism Description MMP-9 was targeted and negatively regulated by hsa-miR494 which inhibited cell proliferation and induced cell apoptosis. Silybin inhibited OS cell viability by altering the protein levels of beta-catenin and RUNX2, thus upregulating the level of hsa-miR494.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [8]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation mTOR signaling pathway Activation hsa04150
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU398 cells Liver Homo sapiens (Human) CVCL_0077
SNU449 cells Liver Homo sapiens (Human) CVCL_0454
SNU475 cells Liver Homo sapiens (Human) CVCL_0497
Experiment for
Molecule Alteration
qPCR; RT-sqPCR
Experiment for
Drug Resistance
Cell viability assay; Caspase-3/7 activity assay; WB analysis
Mechanism Description miR494 overexpression increased sorafenib resistance via mTOR pathway activation in HCC cell lines, by targeting p27, pten, and puma.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [9]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance
MTT assay; Apoptosis assay
Disease Class: Gastric cancer [ICD-11: 2B72.0] [9]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
A549 cells Lung Homo sapiens (Human) CVCL_0023
A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
Experiment for
Drug Resistance
MTT assay; Apoptosis assay
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [10]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-494 Sensitizes Gastric Cancer Cells to TRAIL Treatment Through Down-regulation of Survivin.
References
Ref 1 Overexpression of secretagogin inhibits cell apoptosis and induces chemoresistance in small cell lung cancer under the regulation of miR-494. Oncotarget. 2014 Sep 15;5(17):7760-75. doi: 10.18632/oncotarget.2305.
Ref 2 MicroRNA 494 increases chemosensitivity to doxorubicin in gastric cancer cells by targeting phosphodiesterases 4D. Cell Mol Biol (Noisy-le-grand). 2018 Dec 31;64(15):62-66.
Ref 3 MicroRNA-494 sensitizes colon cancer cells to fluorouracil through regulation of DPYD. IUBMB Life. 2015 Mar;67(3):191-201. doi: 10.1002/iub.1361. Epub 2015 Apr 15.
Ref 4 miR 494 inhibits cancer initiating cell phenotypes and reverses resistance to lapatinib by downregulating FGFR2 in HER2 positive gastric cancer. Int J Mol Med. 2018 Aug;42(2):998-1007. doi: 10.3892/ijmm.2018.3680. Epub 2018 May 16.
Ref 5 MicroRNA-494 Activation Suppresses Bone Marrow Stromal Cell-Mediated Drug Resistance in Acute Myeloid Leukemia Cells. J Cell Physiol. 2017 Jun;232(6):1387-1395. doi: 10.1002/jcp.25628. Epub 2016 Oct 19.
Ref 6 MiR-494-3p mediates oxaliplatin resistance of colorectal cancer cells via PTEN/AKT pathway
Ref 7 Matrix metallopeptidase 9 targeted by hsa-miR-494 promotes silybin-inhibited osteosarcoma. Mol Carcinog. 2018 Feb;57(2):262-271. doi: 10.1002/mc.22753. Epub 2017 Nov 2.
Ref 8 The epigenetically regulated miR-494 associates with stem-cell phenotype and induces sorafenib resistance in hepatocellular carcinoma. Cell Death Dis. 2018 Jan 5;9(1):4. doi: 10.1038/s41419-017-0076-6.
Ref 9 miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.
Ref 10 miR-494 Sensitizes Gastric Cancer Cells to TRAIL Treatment Through Downregulation of Survivin. Cell Physiol Biochem. 2018;51(5):2212-2223. doi: 10.1159/000495867. Epub 2018 Dec 7.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.