Molecule Information
General Information of the Molecule (ID: Mol01506)
| Name |
hsa-mir-494
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 494
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR494
|
||||
| Gene ID | |||||
| Location |
chr14:101029634-101029714[+]
|
||||
| Sequence |
GAUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGAAACAUACACG
GGAAACCUCUUUUUUAGUAUC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [1] | |||
| Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | BCL2 signaling pathway | Activation | hsa04210 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Knockdown of SCGN led to significantly increasing of chemosensitivity, which is similar to those induced by miR-494 mimics, and ectopic expression of SCGN could rescue the suppressive effect of miR-494. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell colony | Activation | hsa05200 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | microRNA 494 increases chemosensitivity to doxorubicin in gastric cancer cells by targeting phosphodiesterases 4D. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [1] | |||
| Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | BCL2 signaling pathway | Activation | hsa04210 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Knockdown of SCGN led to significantly increasing of chemosensitivity, which is similar to those induced by miR-494 mimics, and ectopic expression of SCGN could rescue the suppressive effect of miR-494. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [1] | |||
| Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | BCL2 signaling pathway | Activation | hsa04210 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Knockdown of SCGN led to significantly increasing of chemosensitivity, which is similar to those induced by miR-494 mimics, and ectopic expression of SCGN could rescue the suppressive effect of miR-494. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [3] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | 5-Fu catabolic signaling pathway | Regulation | N.A. | |
| Cell apoptosis | Activation | hsa04210 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| HCT15 cells | Colon | Homo sapiens (Human) | CVCL_0292 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-494 also negatively regulated endogenous DPYD expression in SW480 cells. Overexpression or knockdown of DPYD could attenuate miR-494 mediated 5-Fu sensitivity regulation, suggesting the dependence of DPYD regulation in miR-494 activity. miR-494 inhibited SW480/5-Fu derived xenograft tumors growth in vivo at present of 5-Fu. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Lapatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| In Vitro Model | YCC1 cells | Gastric | Homo sapiens (Human) | CVCL_9646 |
| YCC1-F cells | Gastric | Homo sapiens (Human) | CVCL_9646 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR 494 inhibited the CIC phenotype and reversed resistance to lapatinib by inhibiting FGFR2 in HER2 positive gastric cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] | [5] | |||
| Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
| Sensitive Drug | Mitoxantrone | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
| U937 cells | Blood | Homo sapiens (Human) | CVCL_0007 | |
| KG1a cells | Pleural effusion | Homo sapiens (Human) | CVCL_1824 | |
| In Vivo Model | Mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-494 activation suppresses bone marrow stromal cell-mediated drug resistance in acute myeloid leukemia cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [6] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PTEN/AKT pathway | Regulation | N.A. | |
| In Vitro Model | HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | MiR-494-3p expression in oxaliplatin-resistant HT-29 cells was much higher than that in parental HT-29 cells, accompanied by increased levels of MRP, P-gp, and AKT phosphorylation (p-AKT), and decreased phosphatase and tensin homolog (PTEN) (p < 0.001). The miR-494-3p mimic suppressed oxaliplatin-induced parental HT-29 cell apoptosis, while miR-494-3p inhibitor promoted oxaliplatin-resistant HT-29 cell apoptosis and decreased the levels of p-AKT, MRP and P-gp, while upregulating PTEN (p < 0.001). Furthermore, AKT inhibitor had similar effects as miR-494-3p inhibitor (p < 0.001). Experiments using nude mice demonstrated that inhibition of miR-494-3p accentuated the sensitivity of oxaliplatin-resistant HT-29 cells to oxaliplatin (p < 0.05). | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [7] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Silibinin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
TUNEL cell apoptosis assay; XTT cell proliferation assay; MTT cell proliferation assay; Colony formation assay | |||
| Mechanism Description | MMP-9 was targeted and negatively regulated by hsa-miR494 which inhibited cell proliferation and induced cell apoptosis. Silybin inhibited OS cell viability by altering the protein levels of beta-catenin and RUNX2, thus upregulating the level of hsa-miR494. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [8] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | mTOR signaling pathway | Activation | hsa04150 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| SNU398 cells | Liver | Homo sapiens (Human) | CVCL_0077 | |
| SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
| SNU475 cells | Liver | Homo sapiens (Human) | CVCL_0497 | |
| Experiment for Molecule Alteration |
qPCR; RT-sqPCR | |||
| Experiment for Drug Resistance |
Cell viability assay; Caspase-3/7 activity assay; WB analysis | |||
| Mechanism Description | miR494 overexpression increased sorafenib resistance via mTOR pathway activation in HCC cell lines, by targeting p27, pten, and puma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] | [9] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot | |||
| Experiment for Drug Resistance |
MTT assay; Apoptosis assay | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [9] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot | |||
| Experiment for Drug Resistance |
MTT assay; Apoptosis assay | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [10] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-494 Sensitizes Gastric Cancer Cells to TRAIL Treatment Through Down-regulation of Survivin. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
