Molecule Information

General Information of the Molecule (ID: Mol01493)

• Name: hsa-mir-424 ,Homo sapiens
• Synonyms: microRNA 424
• Molecule Type: Precursor miRNA
• Gene Name: MIR424
• Gene ID: 494336
• Location: chrX:134546614-134546711[-]
• Sequence:
  CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGC
  GCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG
• Ensembl ID: ENSG00000284231
• HGNC ID: HGNC:31881
• Precursor Accession: MI0001446

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] [1]

• Resistant Disease: Laryngeal carcinoma [ICD-11: 2C23.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• Experiment for Molecule Alteration: RT-PCR, microarray analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: A total of 7 differentially expressed miRNAs were identified when Hep-2 and Hep-2/v cells were compared by microarray analysis. Two miRNAs (has-miR-210 and has-miR-923) were significantly up-regulated and five miRNAs (has-miR-93, has-miR-93-star, has-miR-424-star, has-miR-25-star, and has-miR-494) were significantly down-regulated in Hep-2/v cells.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [2]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: CD80/CTLA-4 signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: T-cell apoptosis assay
• Mechanism Description: High expression levels of miR-424(322) were positively correlated with the PFS of ovarian cancer patients. miR-424(322) overexpression reduced PD-L1 and CD80 expression through direct binding to the 3'-UTR of these genes. Furthermore, low miR-424(322) and high PD-L1 expression were significantly correlated and strongly associated with chemoresistant phenotypes in ovarian cancer cells and tissues. Restoration of miR-424(322) expression (+) the sensitivity of cancer cells to drug treatment and was accompanied by T-cell activation by blocking the PD-L1 immune checkpoint in both in vitro and in vivo models. Our current findings indicate that miR-424(322) regulates PD-L1 and CD80 expression. Therefore, miR-424(322) might serve as a therapeutic target to enhance the chemosensitivity of ovarian cancer cells through checkpoint blockage, which thereby promotes the T-cell response in attacking tumour cells.

Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] [3]

• Sensitive Disease: Epidermoid carcinoma [ICD-11: 2C31.Z]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: KB-3-1 cells; Lung; Homo sapiens (Human); CVCL_2088
• In Vitro Model: KB-CP.5 cells; Lung; Homo sapiens (Human); CVCL_IP04
• In Vitro Model: KB-CP20 cells; Lung; Homo sapiens (Human); CVCL_IP06
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [4]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [5]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: PARP cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Hypoxia induces miR-424 expression and that miR-424 in turn suppresses the level of PDCD4 protein, a tumor suppressor that is involved in apoptosis, by targeting its 3' untranslated region. Functionally, miR-424 overexpression decreases the sensitivity of cancer cells (HCT116 and A375) to doxorubicin (Dox) and etoposide. In contrast, the inhibition of miR-424 (+) apoptosis and increased the sensitivity of cancer cells to Dox. In a xenograft tumor model, miR-424 overexpression promoted tumor growth following Dox treatment, suggesting that miR-424 promotes tumor cell resistance to Dox. Furthermore, miR-424 levels are inversely correlated with PDCD4 expression in clinical breast cancer samples.

Disease Class: Melanoma [ICD-11: 2C30.0] [5]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: PARP cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Hypoxia induces miR-424 expression and that miR-424 in turn suppresses the level of PDCD4 protein, a tumor suppressor that is involved in apoptosis, by targeting its 3' untranslated region. Functionally, miR-424 overexpression decreases the sensitivity of cancer cells (HCT116 and A375) to doxorubicin (Dox) and etoposide. In contrast, the inhibition of miR-424 (+) apoptosis and increased the sensitivity of cancer cells to Dox. In a xenograft tumor model, miR-424 overexpression promoted tumor growth following Dox treatment, suggesting that miR-424 promotes tumor cell resistance to Dox. Furthermore, miR-424 levels are inversely correlated with PDCD4 expression in clinical breast cancer samples.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [5]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: PARP cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Hypoxia induces miR-424 expression and that miR-424 in turn suppresses the level of PDCD4 protein, a tumor suppressor that is involved in apoptosis, by targeting its 3' untranslated region. Functionally, miR-424 overexpression decreases the sensitivity of cancer cells (HCT116 and A375) to doxorubicin (Dox) and etoposide. In contrast, the inhibition of miR-424 (+) apoptosis and increased the sensitivity of cancer cells to Dox. In a xenograft tumor model, miR-424 overexpression promoted tumor growth following Dox treatment, suggesting that miR-424 promotes tumor cell resistance to Dox. Furthermore, miR-424 levels are inversely correlated with PDCD4 expression in clinical breast cancer samples.

Disease Class: Melanoma [ICD-11: 2C30.0] [5]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: PARP cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Hypoxia induces miR-424 expression and that miR-424 in turn suppresses the level of PDCD4 protein, a tumor suppressor that is involved in apoptosis, by targeting its 3' untranslated region. Functionally, miR-424 overexpression decreases the sensitivity of cancer cells (HCT116 and A375) to doxorubicin (Dox) and etoposide. In contrast, the inhibition of miR-424 (+) apoptosis and increased the sensitivity of cancer cells to Dox. In a xenograft tumor model, miR-424 overexpression promoted tumor growth following Dox treatment, suggesting that miR-424 promotes tumor cell resistance to Dox. Furthermore, miR-424 levels are inversely correlated with PDCD4 expression in clinical breast cancer samples.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [6]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SUIT-2 cells; Pancreas; Homo sapiens (Human); CVCL_3172
• In Vitro Model: Capan-1 cells; Pancreas; Homo sapiens (Human); CVCL_0237
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Propidium Iodide Assay
• Mechanism Description: They play key roles in regulating the translation and degradation of mRNAs through base pairing to partially complementary sites, predominantly in the 3'-untranslated regions of mRNAs.miR-204 has been also reported to be downregulated in intrahepatic cholangiocarcinoma, and the level of miR-204 expression was inversely correlated with that of Bcl-2 expression, possibly leading to chemotherapeutic drug-triggered apoptosis.

Clinical Trial Drug(s) 2 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [7]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K562/A02 cells; Blood; Homo sapiens (Human); CVCL_0368
• In Vitro Model: NB4 cells; Bone marrow; Homo sapiens (Human); CVCL_0005
• In Vitro Model: HL-60/ADR cells; Blood; Homo sapiens (Human); CVCL_0304
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-424 and miR-27a increase TRAIL sensitivity of acute myeloid leukemia by targeting PLAG1.

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [8]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: miR-424(322) reverses chemoresistance via T-cell immune response activation by blocking the PD-L1 immune checkpoint. Nat Commun. 2016 May 5;7:11406. doi: 10.1038/ncomms11406.
• Ref 3: Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
• Ref 4: Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
• Ref 5: Hypoxia-induced miR-424 decreases tumor sensitivity to chemotherapy by inhibiting apoptosis. Cell Death Dis. 2014 Jun 26;5(6):e1301. doi: 10.1038/cddis.2014.240.
• Ref 6: MicroRNA expression as a predictive marker for gemcitabine response after surgical resection of pancreatic cancer. Ann Surg Oncol. 2011 Aug;18(8):2381-7. doi: 10.1245/s10434-011-1602-x. Epub 2011 Feb 23.
• Ref 7: MiR-424 and miR-27a increase TRAIL sensitivity of acute myeloid leukemia by targeting PLAG1. Oncotarget. 2016 May 3;7(18):25276-90. doi: 10.18632/oncotarget.8252.
• Ref 8: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.