Molecule Information

General Information of the Molecule (ID: Mol01485)

• Name: hsa-mir-342 ,Homo sapiens
• Synonyms: microRNA 342
• Molecule Type: Precursor miRNA
• Gene Name: MIR342
• Gene ID: 442909
• Location: chr14:100109655-100109753[+]
• Sequence:
  GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUG
  UCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA
• Ensembl ID: ENSG00000199082
• HGNC ID: HGNC:31778
• Precursor Accession: MI0000805

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-342 regulates expression of genes involved in tamoxifen mediated tumor cell apoptosis and cell cycle progression.

References

• Ref 1: Downregulation of miR-342 is associated with tamoxifen resistant breast tumors. Mol Cancer. 2010 Dec 20;9:317. doi: 10.1186/1476-4598-9-317.