Molecule Information
General Information of the Molecule (ID: Mol01453)
| Name |
hsa-mir-155
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 155
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR155
|
||||
| Gene ID | |||||
| Location |
chr21:25573980-25574044[+]
|
||||
| Sequence |
CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUU
AACAG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Arsenic trioxide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Nrf2 signaling pathway | Activation | hsa05208 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT Assay | |||
| Mechanism Description | miR155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells. miR155 mediated ATO resistance by upregulating the Nrf2 signaling pathway, but downregulating cellular apoptosis in lung cancer cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [2] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell colony | Activation | hsa05200 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| In Vivo Model | MiR-155 knockout mouse model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTS assay; Caspase 3 activity assay; Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-155 was associated with decreased levels of FOXO3, primarily through inhibiting the expression of FOXO3 to increase colon cancer resistanec to cisplatin. | |||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [3] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| NF-kappaB signaling pathway | Activation | hsa04064 | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Adrenaline increased miR-155 expression in an NFkB dependent manner. HT29 cells overexpressing miR-155 had a higher cell growth rate and more resistance to cisplatin induced apoptosis. In contrast, HT29 cells overexpressing miR-155 inhibitor displayed decreased cell proliferation and sensitivity to cisplatin induced cell death. In summary, our study here revealed that adrenaline-NFkB-miR-155 pathway at least partially contributes to the psychological stress induced proliferation and chemoresistance in HT29 cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [4] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Apaf-1 is a core molecule in the mitochondrial apoptotic pathway, relaying the death signal to the heptameric apoptosome complex to ignite the downstream cascade of caspases. Down-regulation of miR-155 could enhance the sensitivity of A549 cells to cisplatin treatment via restoration of the Apaf-1 pathway. | |||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [5] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR155 reversed EGF-induced EMT by downregulating SMAD2 expression levels, and restraining cell growth by inhibiting CCND1 expression, increased the Chemo-sensitivity of Caski Cells to DDP. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [6] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | During treatment with Dox or Cis in osteosarcoma cells, miR-155 expression was strongly induced. The increased miR-155 expression facilitated tumor cell proliferation via upregulating autophagy, thus, facilitated the resistance of osteosarcoma cells to Dox or Cis. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [7] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expressiom | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| TGF-beta/Smad signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Breast cancer cell lines | Colon | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity. | |||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [8] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Exosome-mediated breast cancer chemoresistance via miR155 transfeRNA Increased miR155 expression increases miR155 content of exosomes, leading to EMT-associated chemoresistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [9] | |||
| Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | RPMI8226/Dox cells | Peripheral blood | Homo sapiens (Human) | CVCL_0014 |
| RPMI8226/S cells | Peripheral blood | Homo sapiens (Human) | CVCL_0014 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Targeting inhibition of miR155 expression could restore chemotherapy sensitivity by increasing FOXO3a expression in drug-resistant myeloma cells. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [10] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT/ERK signaling pathway | Inhibition | hsa04010 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Suppression of miR-155 in this cell line considerably reversed doxorubicin resistance, and doxorubicin-induced apoptosis and cell cycle arrest were recovered. Furthermore, reverse transcription-polymerase chain reaction and western blot analysis revealed that miR-155 suppression downregulated the expression of multidrug resistance protein 1, multidrug resistance-associated protein 1, breast cancer resistance protein, glutathione S-transferase-Pi, Survivin and B-cell lymphoma 2, and upregulated the expression of caspase-3 and caspase-8. In addition, it was found that miR-155 suppression inhibited the activation of AkT and extracellular signal-regulated kinase. The transcriptional activity of nuclear factor-kB and activator protein-1 was also downregulated. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [7] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| TGF-beta/Smad signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Breast cancer cell lines | Colon | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [11] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| Panc1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| PSN1 cells | Pancreas | Homo sapiens (Human) | CVCL_1644 | |
| In Vivo Model | Mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The increase of miR155 induced two different functions; exosome secretion and chemoresistance ability via facilitating the anti-apoptotic activity. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [7] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| TGF-beta/Smad signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Breast cancer cell lines | Colon | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity. | |||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [8] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Exosome-mediated breast cancer chemoresistance via miR155 transfeRNA Increased miR155 expression increases miR155 content of exosomes, leading to EMT-associated chemoresistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [12] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| SOCS6/STAT3 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Inhibition of miR-155 sensitizes breast cancer cells to tamoxifen and SOCS6 sensitizes the cells to tamoxifen. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | [13] | |||
| Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | OCI-Ly7 cells | N.A. | Homo sapiens (Human) | CVCL_1881 |
| SU-DHL-5 cells | N.A. | Homo sapiens (Human) | CVCL_1735 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Dose-response assays | |||
| Mechanism Description | Down-regulation of miR-155 promotes vincristine resistance via upregulating Week1. | |||
Investigative Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant glioma [ICD-11: 2A00.2] | [14] | |||
| Resistant Disease | Malignant glioma [ICD-11: 2A00.2] | |||
| Resistant Drug | NSC141562 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Epithelial mesenchymal transition signaling pathway | Activation | hsa01521 | |
| Wnt/beta-catenin signaling pathway | Activation | hsa04310 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Wound healing assay; Transwell assay; MTT assay | |||
| Mechanism Description | miR155HG Is a Mesenchymal Transition-Associated Long Noncoding RNA, miR155-5p and miR155-3p Are key Derivatives of MIR155HG. miR155-5p or miR155-3p Targets Protocadherin 9 or 7, Respectively, Protocadherin 9 and 7 Function as Tumor Suppressor Genes by Inhibiting the Wnt/ beta-catenin signaling pathway. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Mycosis fungoides [ICD-11: 2B01.0] | [15] | |||
| Resistant Disease | Mycosis fungoides [ICD-11: 2B01.0] | |||
| Resistant Drug | SL111 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MyLa cells | Embryo | Homo sapiens (Human) | N.A. |
| MJ cells | Peripheral blood | Homo sapiens (Human) | CVCL_1414 | |
| In Vivo Model | SCID nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Oncogenic miR-155 appears to contribute to the cancerous phenotype of MyLa and MJ cells. | |||
| Disease Class: Mycosis fungoides [ICD-11: 2B01.0] | [15] | |||
| Resistant Disease | Mycosis fungoides [ICD-11: 2B01.0] | |||
| Resistant Drug | SL111 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MyLa cells | Embryo | Homo sapiens (Human) | N.A. |
| MJ cells | Peripheral blood | Homo sapiens (Human) | CVCL_1414 | |
| In Vivo Model | SCID nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Oncogenic miR-155 appears to contribute to the cancerous phenotype of MyLa and MJ cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
