Molecule Information

General Information of the Molecule (ID: Mol01453)

• Name: hsa-mir-155 ,Homo sapiens
• Synonyms: microRNA 155
• Molecule Type: Precursor miRNA
• Gene Name: MIR155
• Gene ID: 406947
• Location: chr21:25573980-25574044[+]
• Sequence:
  CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUU
  AACAG
• Ensembl ID: ENSG00000283904
• HGNC ID: HGNC:31542
• Precursor Accession: MI0000681

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 14 drug(s) in total

Arsenic trioxide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Arsenic trioxide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Nrf2 signaling pathway; Activation; hsa05208
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT Assay
• Mechanism Description: miR155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells. miR155 mediated ATO resistance by upregulating the Nrf2 signaling pathway, but downregulating cellular apoptosis in lung cancer cells.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [4]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vivo Model: MiR-155 knockout mouse model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay; Caspase 3 activity assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-155 was associated with decreased levels of FOXO3, primarily through inhibiting the expression of FOXO3 to increase colon cancer resistanec to cisplatin.

Disease Class: Colon cancer [ICD-11: 2B90.1] [5]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Activation; hsa04064
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Adrenaline increased miR-155 expression in an NFkB dependent manner. HT29 cells overexpressing miR-155 had a higher cell growth rate and more resistance to cisplatin induced apoptosis. In contrast, HT29 cells overexpressing miR-155 inhibitor displayed decreased cell proliferation and sensitivity to cisplatin induced cell death. In summary, our study here revealed that adrenaline-NFkB-miR-155 pathway at least partially contributes to the psychological stress induced proliferation and chemoresistance in HT29 cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [6]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Apaf-1 is a core molecule in the mitochondrial apoptotic pathway, relaying the death signal to the heptameric apoptosome complex to ignite the downstream cascade of caspases. Down-regulation of miR-155 could enhance the sensitivity of A549 cells to cisplatin treatment via restoration of the Apaf-1 pathway.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [7]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR155 reversed EGF-induced EMT by downregulating SMAD2 expression levels, and restraining cell growth by inhibiting CCND1 expression, increased the Chemo-sensitivity of Caski Cells to DDP.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [8]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: During treatment with Dox or Cis in osteosarcoma cells, miR-155 expression was strongly induced. The increased miR-155 expression facilitated tumor cell proliferation via upregulating autophagy, thus, facilitated the resistance of osteosarcoma cells to Dox or Cis.

Disease Class: Breast cancer [ICD-11: 2C60.3] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expressiom; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: TGF-beta/Smad signaling pathway; Regulation; N.A.
• In Vitro Model: Breast cancer cell lines; Colon; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [ICD-11: 2C60.3] [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Exosome-mediated breast cancer chemoresistance via miR155 transfeRNA Increased miR155 expression increases miR155 content of exosomes, leading to EMT-associated chemoresistance.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [ICD-11: 2A83.0] [11]

• Sensitive Disease: Multiple myeloma [ICD-11: 2A83.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: RPMI8226/Dox cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• In Vitro Model: RPMI8226/S cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Targeting inhibition of miR155 expression could restore chemotherapy sensitivity by increasing FOXO3a expression in drug-resistant myeloma cells.

Disease Class: Lung cancer [ICD-11: 2C25.5] [12]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Inhibition; hsa04010
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Suppression of miR-155 in this cell line considerably reversed doxorubicin resistance, and doxorubicin-induced apoptosis and cell cycle arrest were recovered. Furthermore, reverse transcription-polymerase chain reaction and western blot analysis revealed that miR-155 suppression downregulated the expression of multidrug resistance protein 1, multidrug resistance-associated protein 1, breast cancer resistance protein, glutathione S-transferase-Pi, Survivin and B-cell lymphoma 2, and upregulated the expression of caspase-3 and caspase-8. In addition, it was found that miR-155 suppression inhibited the activation of AkT and extracellular signal-regulated kinase. The transcriptional activity of nuclear factor-kB and activator protein-1 was also downregulated.

Erlotinib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [13]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: TGF-beta/Smad signaling pathway; Regulation; N.A.
• In Vitro Model: Breast cancer cell lines; Colon; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity.

Fulvestrant

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Fulvestrant
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Microarray analysis
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: In cluster 4, mir-155 and its targets showed opposite expression patterns in MCF7-T and MCF7-F and thus could contribute to the different drug-resistant states. As the majority of studies indicate that miR-155 is an oncogene, this miRNA could play a role in acquired resistance to tamoxifen. However, depending on the biological context, it has been suggested that miR-155 may have a tumor suppressor role. Thus, we cannot exclude the possibility that different cellular contexts could also contribute to the distinct drug-resistant phenotypes.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [14]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: PSN1 cells; Pancreas; Homo sapiens (Human); CVCL_1644
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The increase of miR155 induced two different functions; exosome secretion and chemoresistance ability via facilitating the anti-apoptotic activity.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [15]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [16]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: On the other hand, hsa-miR-155 demonstrated a key role in Iri-resistance in all studied colon cancer cell lines through regulating the level of GPT2, NOB1 and KRCC1 (Fig. 6b).

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: TGF-beta/Smad signaling pathway; Regulation; N.A.
• In Vitro Model: Breast cancer cell lines; Colon; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [ICD-11: 2C60.3] [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Exosome-mediated breast cancer chemoresistance via miR155 transfeRNA Increased miR155 expression increases miR155 content of exosomes, leading to EMT-associated chemoresistance.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [17]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: SOCS6/STAT3 signaling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Inhibition of miR-155 sensitizes breast cancer cells to tamoxifen and SOCS6 sensitizes the cells to tamoxifen.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Brain glioma [ICD-11: 2A00.02] [18]

• Resistant Disease: Brain glioma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assay; Cell cycle assay
• Mechanism Description: Combining temozolomide and anti-miR- 155 - 5p inhibits DNA synthesis by causing G2 phase arrest. mRNAs targeted by miR- 155 - 5p and significantly down-regulated in glioblastoma included GABRA1, GABRB2, SCN1A, GRIN2A, and SGIP1. By survival analysis, low expression of SCN1A was associated with poor prognosis (p < 0.05; HR = 0.7), highlighting its potential prognostic role. The combination of temozolomide treatment with suppression of miR- 155 - 5p may provide a more effective and side-effect minimized brain cancer treatment strategy by reducing resistance.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [19]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [20]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: OCI-Ly7 cells; N.A.; Homo sapiens (Human); CVCL_1881
• In Vitro Model: SU-DHL-5 cells; N.A.; Homo sapiens (Human); CVCL_1735
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Dose-response assays
• Mechanism Description: Down-regulation of miR-155 promotes vincristine resistance via upregulating Week1.

Clinical Trial Drug(s) 1 drug(s) in total

PD-0325901

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [13]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: PD-0325901
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

Investigative Drug(s) 2 drug(s) in total

NSC141562

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.2] [21]

• Resistant Disease: Malignant glioma [ICD-11: 2A00.2]
• Resistant Drug: NSC141562
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Activation; hsa01521
• Cell Pathway Regulation: Wnt/beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Wound healing assay; Transwell assay; MTT assay
• Mechanism Description: miR155HG Is a Mesenchymal Transition-Associated Long Noncoding RNA, miR155-5p and miR155-3p Are key Derivatives of MIR155HG. miR155-5p or miR155-3p Targets Protocadherin 9 or 7, Respectively, Protocadherin 9 and 7 Function as Tumor Suppressor Genes by Inhibiting the Wnt/ beta-catenin signaling pathway.

SL111

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Mycosis fungoides [ICD-11: 2B01.0] [22]

• Resistant Disease: Mycosis fungoides [ICD-11: 2B01.0]
• Resistant Drug: SL111
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MyLa cells; Embryo; Homo sapiens (Human); N.A.
• In Vitro Model: MJ cells; Peripheral blood; Homo sapiens (Human); CVCL_1414
• In Vivo Model: SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Oncogenic miR-155 appears to contribute to the cancerous phenotype of MyLa and MJ cells.

Disease Class: Mycosis fungoides [ICD-11: 2B01.0] [22]

• Resistant Disease: Mycosis fungoides [ICD-11: 2B01.0]
• Resistant Drug: SL111
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MyLa cells; Embryo; Homo sapiens (Human); N.A.
• In Vitro Model: MJ cells; Peripheral blood; Homo sapiens (Human); CVCL_1414
• In Vivo Model: SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Oncogenic miR-155 appears to contribute to the cancerous phenotype of MyLa and MJ cells.

References

• Ref 1: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: miR-155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells. Sci Rep. 2017 Sep 22;7(1):12155. doi: 10.1038/s41598-017-06061-x.
• Ref 4: MicroRNA-155 increases colon cancer chemoresistance to cisplatin by targeting forkhead box O3. Oncol Lett. 2018 Apr;15(4):4781-4788. doi: 10.3892/ol.2018.7976. Epub 2018 Feb 7.
• Ref 5: Adrenaline promotes cell proliferation and increases chemoresistance in colon cancer HT29 cells through induction of miR-155. Biochem Biophys Res Commun. 2012 Nov 16;428(2):210-5. doi: 10.1016/j.bbrc.2012.09.126. Epub 2012 Oct 1.
• Ref 6: MiR-155 inhibits the sensitivity of lung cancer cells to cisplatin via negative regulation of Apaf-1 expression. Cancer Gene Ther. 2012 Nov;19(11):773-8. doi: 10.1038/cgt.2012.60. Epub 2012 Sep 21.
• Ref 7: Up-regulated miR155 reverses the epithelial-mesenchymal transition induced by EGF and increases chemo-sensitivity to cisplatin in human Caski cervical cancer cells. PLoS One. 2012;7(12):e52310. doi: 10.1371/journal.pone.0052310. Epub 2012 Dec 20.
• Ref 8: miR-155 mediates drug resistance in osteosarcoma cells via inducing autophagy. Exp Ther Med. 2014 Aug;8(2):527-532. doi: 10.3892/etm.2014.1752. Epub 2014 Jun 2.
• Ref 9: MicroRNA-155 regulates cell survival, growth, and chemosensitivity by targeting FOXO3a in breast cancer. J Biol Chem. 2010 Jun 4;285(23):17869-79. doi: 10.1074/jbc.M110.101055. Epub 2010 Apr 6.
• Ref 10: Exosome-mediated breast cancer chemoresistance via miR-155 transfer. Sci Rep. 2018 Jan 16;8(1):829. doi: 10.1038/s41598-018-19339-5.
• Ref 11: [Targeting miR155 restores chemotherapy sensitivity in drug-resistant myeloma cell-line RPMI8226/DOX cells]. Zhonghua Xue Ye Xue Za Zhi. 2017 Jan 14;38(1):55-59. doi: 10.3760/cma.j.issn.0253-2727.2017.01.012.
• Ref 12: Effect of miR-155 knockdown on the reversal of doxorubicin resistance in human lung cancer A549/dox cells. Oncol Lett. 2016 Feb;11(2):1161-1166. doi: 10.3892/ol.2015.3995. Epub 2015 Dec 3.
• Ref 13: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 14: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma. Sci Rep. 2017 Feb 15;7:42339. doi: 10.1038/srep42339.
• Ref 15: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 16: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 17: MiRNA-155 mediates TAM resistance by modulating SOCS6-STAT3 signalling pathway in breast cancer. Am J Transl Res. 2015 Oct 15;7(10):2115-26. eCollection 2015.
• Ref 18: MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23
• Ref 19: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 20: MicroRNA-155 controls vincristine sensitivity and predicts superior clinical outcome in diffuse large B-cell lymphoma. Blood Adv. 2019 Apr 9;3(7):1185-1196. doi: 10.1182/bloodadvances.2018029660.
• Ref 21: Blocking MIR155HG/miR-155 axis inhibits mesenchymal transition in glioma. Neuro Oncol. 2017 Sep 1;19(9):1195-1205. doi: 10.1093/neuonc/nox017.
• Ref 22: Oncogenic role of microRNA-155 in mycosis fungoides: an in vitro and xenograft mouse model study .Br J Dermatol. 2017 Sep;177(3):791-800. doi: 10.1111/bjd.15422. Epub 2017 May 7. 10.1111/bjd.15422