Molecule Information
General Information of the Molecule (ID: Mol01441)
| Name |
hsa-mir-146a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 146a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR146A
|
||||
| Gene ID | |||||
| Location |
chr5:160485352-160485450[+]
|
||||
| Sequence |
CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUC
UGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUGUCAUCGU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Carboplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [2] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miRNA 146a promotes chemotherapy resistance in lung cancer cells by targeting DNA damage inducible transcript 3 (CHOP). | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [3] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxicity detection kit | |||
| Mechanism Description | For human lung cancer cells, RIP1 plays a role in survival. RIP1 knockdown enhanced cytotoxicity induced by the frontline therapeutic drug cisplatin, which is associated with increased miRNA-146a, reduced catalase expression, ROS induction, and degradation of antiapoptotic IAP proteins. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [4] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| IGROV1 cells | Ovary | Homo sapiens (Human) | CVCL_1304 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
WST assay | |||
| Mechanism Description | Higher expression of miR-146a and miR-150 in omental lesions may lead to more aggressive, chemoresistant disease. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [5] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
| 293T cells | Breast | Homo sapiens (Human) | CVCL_0063 | |
| A549/DDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| SPC-A1/DDP cells | Kidney | Homo sapiens (Human) | CVCL_6955 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Transwell migration assay; Flow cytometric analysis | |||
| Mechanism Description | Up-regulation of miR146a increases the sensitivity of non-small cell lung cancer to DDP by downregulating cyclin J. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [6] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [7] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | IFN-alpha | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Wnt/Beta signaling pathway | Activation | hsa04310 | |
| In Vitro Model | PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-146a confers resistance to IFN-alpha in HCC cells by inhibiting apoptosis through SMAD4. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Mitomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [8] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | miR146a/SOD2/ROS signaling pathway | Regulation | N.A. | |
| In Vitro Model | HEY cells | Ovary | Homo sapiens (Human) | CVCL_0297 |
| OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
| CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; TUNEL Assay | |||
| Mechanism Description | miR146a downregulates the expression of SOD2 and enhances ROS generation, leading to increased apoptosis, inhibition of proliferation, and enhanced sensitivity to chemotherapy. | |||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [8] | |||
| Sensitive Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| miR146a/SOD2/ROS signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; CCK8 assay | |||
| Mechanism Description | miR-146a as a potential tumor suppressor in patients with EOC. miR-146a downregulates expression of SOD2 and enhances ROS generation, leading to increased apoptosis, inhibition of proliferation, and (+) sensitivity to chemotherapy. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCC Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
