Molecule Information

General Information of the Molecule (ID: Mol01441)
Name
hsa-mir-146a ,Homo sapiens
Synonyms
microRNA 146a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR146A
Gene ID
406938
Location
chr5:160485352-160485450[+]
Sequence
CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUC
UGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUGUCAUCGU
    Click to Show/Hide
Ensembl ID
ENSG00000283733
HGNC ID
HGNC:31533
Precursor Accession
MI0000477
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
16 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Mechanism Description Notably, the downregulation of hsa-miR-30a-5p and hsa-miR-146a-5p was associated with increased sensitivity to fluorouracil and oxaliplatin.
Afatinib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Afatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation EGFR and NF-kappaB signaling Regulation N.A.
In Vitro Model H358 cells Lung Homo sapiens (Human) CVCL_1559
H1650 cells Pleural effusion Homo sapiens (Human) CVCL_4V01
H1975 cells Lung Homo sapiens (Human) CVCL_1511
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
H292 cells Lung Homo sapiens (Human) CVCL_0455
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description In functional experiments, miR-146a suppressed cell growth, induced cellular apoptosis and inhibited EGFR downstream signaling in five NSCLC cell lines (H358, H1650, H1975, HCC827 and H292). miR-146a also inhibited the migratory capacity of these NSCLC cells. On the other hand, miR-146a enhanced the inhibition of cell proliferation by drugs targeting EGFR, including both TKIs (gefitinib, erlotinib, and afatinib) and a monoclonal antibody (cetuximab). These effects were independent of the EGFR mutation status (wild type, sensitizing mutation or resistance mutation), but were less potent compared to the effects of siRNA targeting of EGFR. Our results suggest that these effects of miR-146a are due to its targeting of EGFR and NF-kappaB signaling.
Carboplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Carboplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [5]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H446 cells Lung Homo sapiens (Human) CVCL_1562
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miRNA 146a promotes chemotherapy resistance in lung cancer cells by targeting DNA damage inducible transcript 3 (CHOP).
Disease Class: Lung cancer [ICD-11: 2C25.5] [6]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Cytotoxicity detection kit
Mechanism Description For human lung cancer cells, RIP1 plays a role in survival. RIP1 knockdown enhanced cytotoxicity induced by the frontline therapeutic drug cisplatin, which is associated with increased miRNA-146a, reduced catalase expression, ROS induction, and degradation of antiapoptotic IAP proteins.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [7]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
IGROV1 cells Ovary Homo sapiens (Human) CVCL_1304
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 WST assay
Mechanism Description Higher expression of miR-146a and miR-150 in omental lesions may lead to more aggressive, chemoresistant disease.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [8]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
293T cells Breast Homo sapiens (Human) CVCL_0063
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1/DDP cells Kidney Homo sapiens (Human) CVCL_6955
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Transwell migration assay; Flow cytometric analysis
Mechanism Description Up-regulation of miR146a increases the sensitivity of non-small cell lung cancer to DDP by downregulating cyclin J.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [9]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
DU145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration		 qPCR
Mechanism Description Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-146a is increased.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Erlotinib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Erlotinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation EGFR and NF-kappaB signaling Regulation N.A.
In Vitro Model H358 cells Lung Homo sapiens (Human) CVCL_1559
H1650 cells Pleural effusion Homo sapiens (Human) CVCL_4V01
H1975 cells Lung Homo sapiens (Human) CVCL_1511
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
H292 cells Lung Homo sapiens (Human) CVCL_0455
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description In functional experiments, miR-146a suppressed cell growth, induced cellular apoptosis and inhibited EGFR downstream signaling in five NSCLC cell lines (H358, H1650, H1975, HCC827 and H292). miR-146a also inhibited the migratory capacity of these NSCLC cells. On the other hand, miR-146a enhanced the inhibition of cell proliferation by drugs targeting EGFR, including both TKIs (gefitinib, erlotinib, and afatinib) and a monoclonal antibody (cetuximab). These effects were independent of the EGFR mutation status (wild type, sensitizing mutation or resistance mutation), but were less potent compared to the effects of siRNA targeting of EGFR. Our results suggest that these effects of miR-146a are due to its targeting of EGFR and NF-kappaB signaling.
Gefitinib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation EGFR and NF-kappaB signaling Regulation N.A.
In Vitro Model H358 cells Lung Homo sapiens (Human) CVCL_1559
H1650 cells Pleural effusion Homo sapiens (Human) CVCL_4V01
H1975 cells Lung Homo sapiens (Human) CVCL_1511
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
H292 cells Lung Homo sapiens (Human) CVCL_0455
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description In functional experiments, miR-146a suppressed cell growth, induced cellular apoptosis and inhibited EGFR downstream signaling in five NSCLC cell lines (H358, H1650, H1975, HCC827 and H292). miR-146a also inhibited the migratory capacity of these NSCLC cells. On the other hand, miR-146a enhanced the inhibition of cell proliferation by drugs targeting EGFR, including both TKIs (gefitinib, erlotinib, and afatinib) and a monoclonal antibody (cetuximab). These effects were independent of the EGFR mutation status (wild type, sensitizing mutation or resistance mutation), but were less potent compared to the effects of siRNA targeting of EGFR. Our results suggest that these effects of miR-146a are due to its targeting of EGFR and NF-kappaB signaling.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [10]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
IFN-alpha
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [11]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug IFN-alpha
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Wnt/Beta signaling pathway Activation hsa04310
In Vitro Model PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-146a confers resistance to IFN-alpha in HCC cells by inhibiting apoptosis through SMAD4.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [12]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation NF-kappaB signaling Regulation N.A.
In Vitro Model HL-60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
In Vivo Model CML patients Homo sapiens
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR; Western blot
Experiment for
Drug Resistance		 Cell viability assay
Mechanism Description The deregulation of miR-26a, miR-29c, miR-130b, miR-146a and their predicted targets C-IAP-1 and MCL-1 might be a mechanism of IM resistance since these genes are anti-apoptotic and may inhibit the BCR-ABL+ cell death increasing the leukemic cell survival.
Mitomycin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [13]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR146a/SOD2/ROS signaling pathway Regulation N.A.
In Vitro Model HEY cells Ovary Homo sapiens (Human) CVCL_0297
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
CAOV3 cells Ovary Homo sapiens (Human) CVCL_0201
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; TUNEL Assay
Mechanism Description miR146a downregulates the expression of SOD2 and enhances ROS generation, leading to increased apoptosis, inhibition of proliferation, and enhanced sensitivity to chemotherapy.
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [13]
Sensitive Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
miR146a/SOD2/ROS signaling pathway Regulation N.A.
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC cells Liver Homo sapiens (Human) CVCL_0485
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; CCK8 assay
Mechanism Description miR-146a as a potential tumor suppressor in patients with EOC. miR-146a downregulates expression of SOD2 and enhances ROS generation, leading to increased apoptosis, inhibition of proliferation, and (+) sensitivity to chemotherapy.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [14]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance		 Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [15]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
References
Ref 1 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 2 MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23
Ref 3 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 4 Differential miRNA expression profiles in hepatocellular carcinoma cells and drug-resistant sublines. Oncol Rep. 2013 Feb;29(2):555-62. doi: 10.3892/or.2012.2155. Epub 2012 Nov 28.
Ref 5 miRNA 146a promotes chemotherapy resistance in lung cancer cells by targeting DNA damage inducible transcript 3 (CHOP). Cancer Lett. 2018 Aug 1;428:55-68. doi: 10.1016/j.canlet.2018.04.028. Epub 2018 Apr 24.
Ref 6 Receptor-interacting protein 1 increases chemoresistance by maintaining inhibitor of apoptosis protein levels and reducing reactive oxygen species through a microRNA-146a-mediated catalase pathway. J Biol Chem. 2014 Feb 28;289(9):5654-63. doi: 10.1074/jbc.M113.526152. Epub 2014 Jan 14.
Ref 7 Identification of ovarian cancer metastatic miRNAs. PLoS One. 2013;8(3):e58226. doi: 10.1371/journal.pone.0058226. Epub 2013 Mar 12.
Ref 8 Up-regulation of miR-146a increases the sensitivity of non-small cell lung cancer to DDP by downregulating cyclin J. BMC Cancer. 2017 Feb 15;17(1):138. doi: 10.1186/s12885-017-3132-9.
Ref 9 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 10 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 11 miR-146a suppresses the sensitivity to interferon-Alpha in hepatocellular carcinoma cells. Biochem Biophys Res Commun. 2011 Nov 4;414(4):675-80. doi: 10.1016/j.bbrc.2011.09.124. Epub 2011 Oct 1.
Ref 12 Overcoming acquired BRAF inhibitor resistance in melanoma via targeted inhibition of Hsp90 with ganetespibMol Cancer Ther. 2014 Feb;13(2):353-63. doi: 10.1158/1535-7163.MCT-13-0481. Epub 2014 Jan 7.
Ref 13 miR-146a Inhibits Proliferation and Enhances Chemosensitivity in Epithelial Ovarian Cancer via Reduction of SOD2. Oncol Res. 2016;23(6):275-82. doi: 10.3727/096504016X14562725373798.
Ref 14 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 15 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.