General Information of the Molecule (ID: Mol01435)
Name
hsa-mir-125a ,Homo sapiens
Synonyms
microRNA 125a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR125A
Gene ID
406910
Location
chr19:51693254-51693339[+]
Sequence
UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUCCAGGGUCACAGGUGA
GGUUCUUGGGAGCCUGGCGUCUGGCC
    Click to Show/Hide
Ensembl ID
ENSG00000208008
HGNC ID
HGNC:31505
Precursor Accession
MI0000469
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [1]
Resistant Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
p53 signaling pathway Inhibition hsa04115
In Vitro Model CNE1 cells Throat Homo sapiens (Human) CVCL_6888
CNE-2 cells Nasopharynx Homo sapiens (Human) CVCL_6888
TW03 cells Nasopharynx Homo sapiens (Human) CVCL_6010
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description In the TW03/DDP cells, the expression levels of miR 125a and miR 125b were upregulated, and this caused downregulation of p53. Ectopic expression of these miRNAs in the TW03 cell model sensitized TW03 to cisplatin by decreasing the protein expression levels of p53, whereas ectopic expression in the antisense oligos of these microRNAs demonstrated the opposite effect. In addition, the present demonstrated that the cisplatin induced expression of miR 125a and miR 125b inhibited cisplatin induced apoptosis in the TW03 cells by decreasing the protein expression levels of p53. Taken together, the present study revealed for the first time, to the best of our knowledge, that induction of the expression of miR 125a and miR 125b by treatment with cisplatin resulted in resistance to the cisplatin drug in the NPC cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal cancer [2]
Sensitive Disease Laryngeal cancer [ICD-11: 2C23.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEp-2 cells Skin Homo sapiens (Human) CVCL_1906
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC apoptosis assay
Mechanism Description Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.
Daunorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [3]
Resistant Disease Leukemia [ICD-11: 2B33.6]
Resistant Drug Daunorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model THP-1 cells Blood Homo sapiens (Human) CVCL_0006
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Luminescent cell viability assay
Mechanism Description miR125a mediated daunorubicin resistance in leukemia cell lines through the decrease of GRk2 and Puma which were proved to be direct targets of miR125a. Overexpression of miR125a induced drug resistance in HL-60, k562, and THP-1cell lines through reducing apoptosis.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal cancer [2]
Sensitive Disease Laryngeal cancer [ICD-11: 2C23.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEp-2 cells Skin Homo sapiens (Human) CVCL_1906
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC apoptosis assay
Mechanism Description Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal cancer [2]
Sensitive Disease Laryngeal cancer [ICD-11: 2C23.1]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEp-2 cells Skin Homo sapiens (Human) CVCL_1906
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC apoptosis assay
Mechanism Description Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [4]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-125a may promote chemo-resistance to gemcitabine in pancreatic cell lines through targeting A20, which may provide novel therapeutic targets or molecular biomarkers for cancer therapy and improve tumor diagnosis or predictions of therapeutic responses.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [5]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model BALB/C nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-125a/b significantly inhibited ALDH1A3 and Mcl1 expression, reduced cell survival, and increased cell apoptosis in HT29-taxol cells. Chemoresistance to paclitaxel is initiated by the downregulation of miR-125a/b expression, which subsequently upregulates ALDH1A3 and Mcl1 expression to promote survival of CSCs.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal cancer [2]
Sensitive Disease Laryngeal cancer [ICD-11: 2C23.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEp-2 cells Skin Homo sapiens (Human) CVCL_1906
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC apoptosis assay
Mechanism Description Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1.
References
Ref 1 Has miR 125a and 125b are induced by treatment with cisplatin in nasopharyngeal carcinoma and inhibit apoptosis in a p53 dependent manner by targeting p53 mRNA. Mol Med Rep. 2015 Sep;12(3):3569-3574. doi: 10.3892/mmr.2015.3863. Epub 2015 May 27.
Ref 2 Inhibition of HAX-1 by miR-125a reverses cisplatin resistance in laryngeal cancer stem cells. Oncotarget. 2016 Dec 27;7(52):86446-86456. doi: 10.18632/oncotarget.13424.
Ref 3 Involvement of miR-125a in resistance to daunorubicin by inhibiting apoptosis in leukemia cell lines. Tumour Biol. 2017 Apr;39(4):1010428317695964. doi: 10.1177/1010428317695964.
Ref 4 MiR-125a regulates chemo-sensitivity to gemcitabine in human pancreatic cancer cells through targeting A20. Acta Biochim Biophys Sin (Shanghai). 2016 Feb;48(2):202-8. doi: 10.1093/abbs/gmv129. Epub 2016 Jan 11.
Ref 5 MiR-125a/b regulates the activation of cancer stem cells in paclitaxel-resistant colon cancer. Cancer Invest. 2013 Jan;31(1):17-23. doi: 10.3109/07357907.2012.743557.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.