Molecule Information
General Information of the Molecule (ID: Mol01435)
| Name |
hsa-mir-125a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 125a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR125A
|
||||
| Gene ID | |||||
| Location |
chr19:51693254-51693339[+]
|
||||
| Sequence |
UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUCCAGGGUCACAGGUGA
GGUUCUUGGGAGCCUGGCGUCUGGCC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [1] | |||
| Resistant Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| p53 signaling pathway | Inhibition | hsa04115 | ||
| In Vitro Model | CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 |
| CNE-2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6888 | |
| TW03 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6010 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | In the TW03/DDP cells, the expression levels of miR 125a and miR 125b were upregulated, and this caused downregulation of p53. Ectopic expression of these miRNAs in the TW03 cell model sensitized TW03 to cisplatin by decreasing the protein expression levels of p53, whereas ectopic expression in the antisense oligos of these microRNAs demonstrated the opposite effect. In addition, the present demonstrated that the cisplatin induced expression of miR 125a and miR 125b inhibited cisplatin induced apoptosis in the TW03 cells by decreasing the protein expression levels of p53. Taken together, the present study revealed for the first time, to the best of our knowledge, that induction of the expression of miR 125a and miR 125b by treatment with cisplatin resulted in resistance to the cisplatin drug in the NPC cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Laryngeal cancer [ICD-11: 2C23.1] | [2] | |||
| Sensitive Disease | Laryngeal cancer [ICD-11: 2C23.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEp-2 cells | Skin | Homo sapiens (Human) | CVCL_1906 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC apoptosis assay | |||
| Mechanism Description | Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Leukemia [ICD-11: 2B33.6] | [3] | |||
| Resistant Disease | Leukemia [ICD-11: 2B33.6] | |||
| Resistant Drug | Daunorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | THP-1 cells | Blood | Homo sapiens (Human) | CVCL_0006 |
| HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 | |
| K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Luminescent cell viability assay | |||
| Mechanism Description | miR125a mediated daunorubicin resistance in leukemia cell lines through the decrease of GRk2 and Puma which were proved to be direct targets of miR125a. Overexpression of miR125a induced drug resistance in HL-60, k562, and THP-1cell lines through reducing apoptosis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Laryngeal cancer [ICD-11: 2C23.1] | [2] | |||
| Sensitive Disease | Laryngeal cancer [ICD-11: 2C23.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEp-2 cells | Skin | Homo sapiens (Human) | CVCL_1906 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC apoptosis assay | |||
| Mechanism Description | Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Laryngeal cancer [ICD-11: 2C23.1] | [2] | |||
| Sensitive Disease | Laryngeal cancer [ICD-11: 2C23.1] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEp-2 cells | Skin | Homo sapiens (Human) | CVCL_1906 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC apoptosis assay | |||
| Mechanism Description | Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [4] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 |
| SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-125a may promote chemo-resistance to gemcitabine in pancreatic cell lines through targeting A20, which may provide novel therapeutic targets or molecular biomarkers for cancer therapy and improve tumor diagnosis or predictions of therapeutic responses. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [5] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| In Vivo Model | BALB/C nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR-125a/b significantly inhibited ALDH1A3 and Mcl1 expression, reduced cell survival, and increased cell apoptosis in HT29-taxol cells. Chemoresistance to paclitaxel is initiated by the downregulation of miR-125a/b expression, which subsequently upregulates ALDH1A3 and Mcl1 expression to promote survival of CSCs. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Laryngeal cancer [ICD-11: 2C23.1] | [2] | |||
| Sensitive Disease | Laryngeal cancer [ICD-11: 2C23.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HEp-2 cells | Skin | Homo sapiens (Human) | CVCL_1906 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC apoptosis assay | |||
| Mechanism Description | Inhibition of HAX-1 by miR125a reverses cisplatin resistance in laryngeal cancer stem cells. Overexpression of miR125a increases the sensitivity of Hep-2-CSCs to cisplatin by inhibiting HAX-1. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
