Molecule Information
General Information of the Molecule (ID: Mol01429)
Name |
hsa-mir-143
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 143
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR143
|
||||
Gene ID | |||||
Location |
chr5:149428918-149429023[+]
|
||||
Sequence |
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUC
UGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [1] | |||
Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
Sensitive Drug | Cetuximab | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
EGFR/RAS/MAPK signaling pathway | Regulation | hsa01521 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
Northern blot analysis | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | The extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. restoration of miR-143 or miR-145 reduces the aggressiveness of mutant kRAS HCT116 cells. In addition, forced expression of these miRNAs in both mutant and wild-type kRAS colon cancer cells increased their sensitivity to cetuximab by increasing cetuximab-mediated ADCC. Moreover, increased levels of effector cell-mediated caspase-dependent apoptosis were observed for mutant kRAS HCT116 miRNAs-overexpressing cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [2] | |||
Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
Cell proliferation | Inhibition | hsa05200 | ||
EGFR/RAS/MAPK signaling pathway | Inhibition | hsa01521 | ||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-143 plays an important role in prostate cancer proliferation, migration and chemosensitivity by suppressing kRAS and subsequent inactivation of MAPk pathway. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [3] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
In Vivo Model | NOD-SCID IL2-rgamma -null (NSG) mouse engraftment model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Matrigel colony formation assay; Hoechst33342 staining assay | |||
Mechanism Description | In chemoresistant SAOS-2 and U2OS osteosarcomas cells, miR-143 levels were significantly downregulated and accompanied by increases in ATG2B, Bcl-2, and/or LC3-II protein levels, high rate of ALDH1+CD133+ cells, and an increase in Matrigel colony formation ability. H2O2 upregulated p53 and miR-143, but downregulated ATG2B, Bcl-2, and LC3-I expression in U2OS cells (wild-type p53) but not in SAOS-2 (p53-null) cells. Forced miR-143 expression significantly reversed chemoresistance as well as downregulation of ATG2B, LC3-I, and Bcl-2 expression in SAOS-2- and U2OS-resistant cells. Forced miR-143 expression significantly inhibited tumor growth in xenograft SAOS-2-Dox and U2OS-Dox animal models. Loss of miR-143 expression is associated with poor prognosis of patients with osteosarcoma underlying chemotherapy. The chemoresistance of osteosarcoma tumor cells to doxorubicin is associated with the downregulation of miR-143 expression, activation of ALDH1+CD133+ cells, activation of autophagy, and inhibition of cell death. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [4] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
NF-kappaB signaling pathway | Regulation | hsa04064 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | miR-143 increases the sensitivity of colon cancer cells to 5-fluorouracil, probably acting through extracellular-regulated protein kinase 5/nuclear factor-kB regulated pathways. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [5] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [6] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
IGF1R signaling pathway | Inhibition | hsa05200 | ||
MAPK sigaling pathway | Inhibition | hsahsa04 | ||
PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
SV-HUC-1 cells | Bladder | Homo sapiens (Human) | CVCL_3798 | |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR143 inhibits bladder cancer cell proliferation and enhances their sensitivity to gemcitabine by repressing IGF-1R signaling. Down-regulation of miR143 in bladder cancer may be involved in tumor development via the activation of IGF-1R and other downstream pathways like PI3k/Akt and MAPk. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [7] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
PI3K/AKT/HIF-1/VEGF signaling pathway | Activation | hsa04151 | ||
In Vitro Model | SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Overexpression of miR-143 inhibited cell proliferation, migration, tumor growth and angiogenesis and increased chemosensitivity to oxaliplatin treatment in an IGF-IR-dependent manner. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [8] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | miR143/CIAPIN1 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
MDA-MB-453 cells | Breast | Homo sapiens (Human) | CVCL_0418 | |
HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Upregulation of microRNA-143 reverses drug resistance in human breast cancer cells via inhibition of cytokine-induced apoptosis inhibitor 1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [9] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
MAPK/ERK signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
In Vivo Model | BALB/c nude mice | Mus musculus | ||
Experiment for Molecule Alteration |
Western blotting analysis; RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Matrigel assay; Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-143 decreased glioma cell migration, invasion, tube formation and slowed tumor growth and angiogenesis in a manner associated with N-RAS downregulation in vitro and in vivo. miR-143 also sensitizes glioma cells to temozolomide (TMZ),the first-line drug for glioma treatment. | |||
Disease Class: Glioblastoma | [9] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
MAPK/ERK signaling pathway | Inhibition | hsa04010 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
In Vivo Model | BALB/c nude mice | Mus musculus | ||
Experiment for Molecule Alteration |
Western blotting analysis; RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Matrigel assay; Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-143 decreased glioma cell migration, invasion, tube formation and slowed tumor growth and angiogenesis in a manner associated with N-RAS downregulation in vitro and in vivo. miR-143 also sensitizes glioma cells to temozolomide (TMZ),the first-line drug for glioma treatment. |
Investigative Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [10] | |||
Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Sensitive Drug | Isoarnebin 4 | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
Mitochondrial apoptotic signaling pathway | Activation | hsa04210 | ||
In Vitro Model | GBM cells | Brain | Homo sapiens (Human) | N.A. |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-143 enhances the antitumor activity of shikonin by targeting BAG3 and reducing its expression in human glioblastoma stem cell. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.