General Information of the Molecule (ID: Mol01429)
Name
hsa-mir-143 ,Homo sapiens
Synonyms
microRNA 143
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR143
Gene ID
406935
Location
chr5:149428918-149429023[+]
Sequence
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUC
UGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
    Click to Show/Hide
Ensembl ID
ENSG00000284182
HGNC ID
HGNC:31530
Precursor Accession
MI0000459
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
EGFR/RAS/MAPK signaling pathway Regulation N.A.
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
Northern blot analysis
Experiment for
Drug Resistance
MTS assay
Mechanism Description The extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. restoration of miR-143 or miR-145 reduces the aggressiveness of mutant kRAS HCT116 cells. In addition, forced expression of these miRNAs in both mutant and wild-type kRAS colon cancer cells increased their sensitivity to cetuximab by increasing cetuximab-mediated ADCC. Moreover, increased levels of effector cell-mediated caspase-dependent apoptosis were observed for mutant kRAS HCT116 miRNAs-overexpressing cells.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
Immunohistochemistry; immunofluorescence staining; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description We investigated the possible role of miR-143 in the development of cisplatin resistance in human gastric cancer cell line
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [3]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
EGFR/RAS/MAPK signaling pathway Inhibition hsa01521
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-143 plays an important role in prostate cancer proliferation, migration and chemosensitivity by suppressing kRAS and subsequent inactivation of MAPk pathway.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
In Vivo Model NOD-SCID IL2-rgamma -null (NSG) mouse engraftment model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Matrigel colony formation assay; Hoechst33342 staining assay
Mechanism Description In chemoresistant SAOS-2 and U2OS osteosarcomas cells, miR-143 levels were significantly downregulated and accompanied by increases in ATG2B, Bcl-2, and/or LC3-II protein levels, high rate of ALDH1+CD133+ cells, and an increase in Matrigel colony formation ability. H2O2 upregulated p53 and miR-143, but downregulated ATG2B, Bcl-2, and LC3-I expression in U2OS cells (wild-type p53) but not in SAOS-2 (p53-null) cells. Forced miR-143 expression significantly reversed chemoresistance as well as downregulation of ATG2B, LC3-I, and Bcl-2 expression in SAOS-2- and U2OS-resistant cells. Forced miR-143 expression significantly inhibited tumor growth in xenograft SAOS-2-Dox and U2OS-Dox animal models. Loss of miR-143 expression is associated with poor prognosis of patients with osteosarcoma underlying chemotherapy. The chemoresistance of osteosarcoma tumor cells to doxorubicin is associated with the downregulation of miR-143 expression, activation of ALDH1+CD133+ cells, activation of autophagy, and inhibition of cell death.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
NF-kappaB signaling pathway Regulation N.A.
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-143 increases the sensitivity of colon cancer cells to 5-fluorouracil, probably acting through extracellular-regulated protein kinase 5/nuclear factor-kB regulated pathways.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [6]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [7]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
IGF1R signaling pathway Inhibition hsa05200
MAPK sigaling pathway Inhibition hsahsa04
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
SV-HUC-1 cells Bladder Homo sapiens (Human) CVCL_3798
T24 cells Bladder Homo sapiens (Human) CVCL_0554
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR143 inhibits bladder cancer cell proliferation and enhances their sensitivity to gemcitabine by repressing IGF-1R signaling. Down-regulation of miR143 in bladder cancer may be involved in tumor development via the activation of IGF-1R and other downstream pathways like PI3k/Akt and MAPk.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
PI3K/AKT/HIF-1/VEGF signaling pathway Activation hsa04151
In Vitro Model SW1116 cells Colon Homo sapiens (Human) CVCL_0544
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Overexpression of miR-143 inhibited cell proliferation, migration, tumor growth and angiogenesis and increased chemosensitivity to oxaliplatin treatment in an IGF-IR-dependent manner.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [9]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR143/CIAPIN1 signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Upregulation of microRNA-143 reverses drug resistance in human breast cancer cells via inhibition of cytokine-induced apoptosis inhibitor 1.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [10]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
MAPK/ERK signaling pathway Inhibition hsa04010
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model BALB/c nude mice Mus musculus
Experiment for
Molecule Alteration
Western blot analysis; RT-PCR; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Matrigel assay; Flow cytometry assay
Mechanism Description Overexpression of miR-143 decreased glioma cell migration, invasion, tube formation and slowed tumor growth and angiogenesis in a manner associated with N-RAS downregulation in vitro and in vivo. miR-143 also sensitizes glioma cells to temozolomide (TMZ),the first-line drug for glioma treatment.
Disease Class: Glioblastoma [ICD-11: 2A00.02] [10]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
MAPK/ERK signaling pathway Inhibition hsa04010
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model BALB/c nude mice Mus musculus
Experiment for
Molecule Alteration
Western blot analysis; RT-PCR; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Matrigel assay; Flow cytometry assay
Mechanism Description Overexpression of miR-143 decreased glioma cell migration, invasion, tube formation and slowed tumor growth and angiogenesis in a manner associated with N-RAS downregulation in vitro and in vivo. miR-143 also sensitizes glioma cells to temozolomide (TMZ),the first-line drug for glioma treatment.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Isoarnebin 4
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [11]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Isoarnebin 4
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Mitochondrial apoptotic signaling pathway Activation hsa04210
In Vitro Model GBM cells Brain Homo sapiens (Human) N.A.
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-143 enhances the antitumor activity of shikonin by targeting BAG3 and reducing its expression in human glioblastoma stem cell.
References
Ref 1 miR-143 or miR-145 overexpression increases cetuximab-mediated antibody-dependent cellular cytotoxicity in human colon cancer cells. Oncotarget. 2016 Feb 23;7(8):9368-87. doi: 10.18632/oncotarget.7010.
Ref 2 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 3 miR-143 decreases prostate cancer cells proliferation and migration and enhances their sensitivity to docetaxel through suppression of KRAS. Mol Cell Biochem. 2011 Apr;350(1-2):207-13. doi: 10.1007/s11010-010-0700-6. Epub 2011 Jan 1.
Ref 4 microRNA-143 is associated with the survival of ALDH1+CD133+ osteosarcoma cells and the chemoresistance of osteosarcoma. Exp Biol Med (Maywood). 2015 Jul;240(7):867-75. doi: 10.1177/1535370214563893. Epub 2015 Jan 8.
Ref 5 MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells. FEBS J. 2009 Nov;276(22):6689-700. doi: 10.1111/j.1742-4658.2009.07383.x. Epub 2009 Oct 16.
Ref 6 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 7 miR-143 inhibits bladder cancer cell proliferation and enhances their sensitivity to gemcitabine by repressing IGF-1R signaling. Oncol Lett. 2017 Jan;13(1):435-440. doi: 10.3892/ol.2016.5388. Epub 2016 Nov 16.
Ref 8 MicroRNA-143 inhibits tumor growth and angiogenesis and sensitizes chemosensitivity to oxaliplatin in colorectal cancers. Cell Cycle. 2013 May 1;12(9):1385-94. doi: 10.4161/cc.24477. Epub 2013 Apr 8.
Ref 9 Upregulation of microRNA-143 reverses drug resistance in human breast cancer cells via inhibition of cytokine-induced apoptosis inhibitor 1. Oncol Lett. 2017 Jun;13(6):4695-4700. doi: 10.3892/ol.2017.6078. Epub 2017 Apr 24.
Ref 10 Tumour exosomes from cells harbouring PTPRZ1-MET fusion contribute to a malignant phenotype and temozolomide chemoresistance in glioblastoma .Oncogene. 2017 Sep 21;36(38):5369-5381. doi: 10.1038/onc.2017.134. Epub 2017 May 15. 10.1038/onc.2017.134
Ref 11 MiR-143 enhances the antitumor activity of shikonin by targeting BAG3 expression in human glioblastoma stem cells. Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):105-12. doi: 10.1016/j.bbrc.2015.10.153. Epub 2015 Nov 2.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.