Molecule Information

General Information of the Molecule (ID: Mol01428)

• Name: hsa-mir-141 ,Homo sapiens
• Synonyms: microRNA 141
• Molecule Type: Precursor miRNA
• Gene Name: MIR141
• Gene ID: 406933
• Location: chr12:6964097-6964191[+]
• Sequence:
  CGGCCGGCCCUGGGUCCAUCUUCCAGUACAGUGUUGGAUGGUCUAAUUGUGAAGCUCCUA
  ACACUGUCUGGUAAAGAUGGCUCCCGGGUGGGUUC
• Ensembl ID: ENSG00000207708
• HGNC ID: HGNC:31528
• Precursor Accession: MI0000457

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 14 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: MES-OV cells; Ovary; Homo sapiens (Human); CVCL_CZ92
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: SRB colorimetric assay; Flow cytometry assay
• Mechanism Description: The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay and TUNEL assay
• Mechanism Description: miR-141 expression was significantly up-regulated in cisplatin-resistant A549/DDP cells compared with the parental cell line A549; and PDCD4, an important apoptosis regulator, was found to be down-regulated. Luciferase activity assay and Western blot analysis confirmed that PDCD4 is a direct target of miR-141. Inhibition of miR-141 in A549/DDP cells markedly increased cisplatin sensitivity and apoptosis, which was partially abrogated by PDCD4 inhibition, indicating that PDCD4 is a functional target of miR-141 in of the regulation of cisplatin sensitivity.

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: NF-kappaB signaling pathway; Activation; hsa04064
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 DDP cells; Ovary; Homo sapiens (Human); CVCL_D619
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-141 regulates the expression of kEAP1 and that the repression of kEAP1 contributes to cisplatin resistance. Inhibition of NF-kB signaling enhances miR-141-mediated cisplatin sensitivity.

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [4]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: KYSE70 cells; Esophagus; Homo sapiens (Human); CVCL_1356
• In Vitro Model: KYSE140 cells; Esophagus; Homo sapiens (Human); CVCL_1347
• In Vitro Model: KYSE170 cells; Esophagus; Homo sapiens (Human); CVCL_1358
• In Vitro Model: KYSE190 cells; Esophagus; Homo sapiens (Human); CVCL_8301
• In Vitro Model: KYSE520 cells; Esophagus; Homo sapiens (Human); CVCL_1355
• In Vitro Model: KYSE590 cells; Esophagus; Homo sapiens (Human); CVCL_8508
• In Vitro Model: KYSE890 cells; Esophagus; Homo sapiens (Human); CVCL_A103
• In Vitro Model: KYSE960 cells; Esophagus; Homo sapiens (Human); CVCL_8512
• In Vitro Model: kYSE450 cells; Esophagus; Homo sapiens (Human); CVCL_1353
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: When miR-141, which was the most highly expressed miRNA in the cisplatin-resistant cell lines, was expressed ectopically in thecisplatin-sensitive cell lines, cell viability after cisplatin treatment was increased significantly. miR-141 directly targeted the 3 -untranslated region ofYAP1, which is known to have a crucial role in apoptosis inducedby DNA-damaging agents, and thus downregulated YAP1 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.11] [5]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.11]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: IMR-32 cells; Abdomen; Homo sapiens (Human); CVCL_0346
• In Vitro Model: Sk-N-AS cells; Adrenal; Homo sapiens (Human); CVCL_1700
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In the IMR-32 and SH-SY5Y cells, lentivirus-induced miR-141 upregulation inhibited cancer proliferation, cell cycle progression, migration and increased cisplatin chemosensitivity in vitro. In addition, miR-141 upregulation reduced the in vivo growth of IMR-32 tumor explants. FUS was found to be inversely regulated by miR-141 in NB. Small interfering RNA (siRNA)-induced FUS downregulation had similar tumor-suppressive effects as miR-141 upregulation on NB cell proliferation, cell cycle progression, migration and cisplatin chemosensitivity.

Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Knockdown miR-141 expression in 7901/DDP and 7901 cells could significantly improve cisplatin sensitivity. Over-expression of miR-141 resulted in (+) resistance to cisplatin in both gastric cancer cells. We also demonstrated that miR-141 directly targets kEAP1 by luciferase reporter assay, and that down-regulation of kEAP1 induces cisplatin resistance. Conversely, over-expression of kEAP1 significantly (+) cisplatin sensitivity. Our 75 pairs of tissues also showed that kEAP1 was significantly up-regulated in H. pylori-positive tissues.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-141 affected the chemosensitivity of BC cells to docetaxel by directly targeting EIF4E, due to its anti-apoptotic properties. Transfection of miR-141 inhibitor could significantly promote docetaxel-induced apoptosis and change the expression of Bax and Bcl-2. However, when the BC cells were transfected with siRNA-EIF4E, the data showed opposite results. It suggested that EIF4E is partly responsible for the miR-141-induced apoptosis which is related to the mitochondrial apoptosis pathway. In the previous studies, antisense Bcl-2 treatment (+) sensitivity to tamoxifen in HER2-positive cells in tamoxifen-resistant BC cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [9]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: EIF4E/VEGF/c-Myc/Bax signaling pathway; Activation; hsa04066
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: H2009 cells; Lung; Homo sapiens (Human); CVCL_1514
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC Apoptosis assay
• Mechanism Description: Down-regulation of miR141 suppressed cell proliferation, induced cell death and increased caspase-3 activity in H1299 or H2009/docetaxel cells. Down-regulation of miR141 also increased the protein expression of EIF4E, VEGF, c-Myc and Bax in H1299 or H2009/docetaxel cells.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [11]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Integrin signalling; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: High-throughput miRNA analysis
• Experiment for Drug Resistance: Sulforhodamine-B assay
• Mechanism Description: Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [12]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Flow cytometry assay; MTS assay
• Mechanism Description: miR141 inhibited CRC cell proliferation via targeting cyclin D2, which is involved in cell cycle regulation, and inhibited the mainte.nce of CSC stemness, thereby enhancing drug susceptibility.

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [13]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Nrf2 signaling pathway; Inhibition; hsa05208
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Cells with kRAL overexpression exhibited a reversal in the resistance against 5-FU, with a significant decrease in the IC50 and a dramatic increase in cellular apoptosis, while silencing keap1 or ectopically expressing miR-141 partially rescued this effect.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [14]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Intedanib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [15]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Intedanib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• In Vitro Model: EBC-1 cells; Lung; Homo sapiens (Human); CVCL_2891
• In Vitro Model: LC-1/sq cells; Lung; Homo sapiens (Human); CVCL_3008
• In Vitro Model: LC-2/ad cells; Lung; Homo sapiens (Human); CVCL_1373
• In Vitro Model: Lk-2 cells; Lung; Homo sapiens (Human); CVCL_1377
• In Vitro Model: NCI-HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC-1 cells; Pancreas; Homo sapiens (Human); CVCL_S978
• In Vitro Model: PC-10 cells; Lung; Homo sapiens (Human); CVCL_7088
• In Vitro Model: QG56 cells; Lung; Homo sapiens (Human); CVCL_6943
• In Vitro Model: RERF-LCkJ cells; Lung; Homo sapiens (Human); CVCL_1654
• In Vitro Model: SQ5 cells; Lung; Homo sapiens (Human); CVCL_8273
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-200b and miR-141 associated with epithelial-mesenchymal transition (EMT) are predictive biomarkers and therapeutic targets of nintedanib in NSCLC cells. nintedanib inhibited EMT and reversed the resistance to EGFR-TkI with TGF-beta-induced EMT through miR-200 family induction in NSCLC cells. low expression of miR-200b and miR-141, resulting in high level of ZEB1 and low level of E-cadherin, was associated with the resistance to nintedanib in NSCLC cells.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [16]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Beta-catenin signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: NOD/SCID mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: CAF-derived exosomes transfer LncRNA H19 to colorectal cancer cells and H19 activated the beta-catenin pathway via acting as a competing endogenous RNA sponge for miR-141, while miR-141 inhibited the stemness of CRC cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [12]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Flow cytometry assay; MTS assay
• Mechanism Description: miR141 inhibited CRC cell proliferation via targeting cyclin D2, which is involved in cell cycle regulation, and inhibited the mainte.nce of CSC stemness, thereby enhancing drug susceptibility.

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [17]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of MEG3 improved oxaliplatin sensitivity of HT29/OXA and HCT116/OXA cells via suppressing miR-141 expression and upregulating PDCD4.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: MES-OV cells; Ovary; Homo sapiens (Human); CVCL_CZ92
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: SRB colorimetric assay; Flow cytometry assay
• Mechanism Description: The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells.

Sunitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Clear cell renal cell carcinoma [ICD-11: 2C90.Y] [18]

• Sensitive Disease: Clear cell renal cell carcinoma [ICD-11: 2C90.Y]
• Sensitive Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: RCC4 cells; Kidney; Homo sapiens (Human); CVCL_0498
• In Vitro Model: UMRC-2 cells; Kidney; Homo sapiens (Human); CVCL_2739
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Compared to good responders, microRNA-141 was significantly down-regulated in tumors of poor responders to sunitinib. This seemed spatially linked toepithelial-to-mesenchymaltransitioninvivo. microRNA-141 down-regulation driven epithelial-to-mesenchymal transition in clear cell renal cell carcinoma was linked to anunfavorable response to sunitinib therapy.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [11]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [19]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: TGF-beta signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [7]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Clinical Trial Drug(s) 2 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

PD-0325901

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [20]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: PD-0325901
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MEK-EGFR-PI3K signalling pathway; Regulation; N.A.
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

References

• Ref 1: The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cells. Mol Oncol. 2015 Oct;9(8):1678-93. doi: 10.1016/j.molonc.2015.04.015. Epub 2015 May 16.
• Ref 2: Inhibition of miR-141 reverses cisplatin resistance in non-small cell lung cancer cells via upregulation of programmed cell death protein 4. Eur Rev Med Pharmacol Sci. 2016 Jun;20(12):2565-72.
• Ref 3: miR-141 regulates KEAP1 and modulates cisplatin sensitivity in ovarian cancer cells. Oncogene. 2013 Sep 5;32(36):4284-93. doi: 10.1038/onc.2012.433. Epub 2012 Oct 8.
• Ref 4: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.
• Ref 5: MicroRNA-141 and its associated gene FUS modulate proliferation, migration and cisplatin chemosensitivity in neuroblastoma cell lines. Oncol Rep. 2016 May;35(5):2943-51. doi: 10.3892/or.2016.4640. Epub 2016 Feb 26.
• Ref 6: Helicobacter pylori modulates cisplatin sensitivity in gastric cancer by down-regulating miR-141 expression. Helicobacter. 2014 Jun;19(3):174-81. doi: 10.1111/hel.12120. Epub 2014 Mar 17.
• Ref 7: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 8: miR-141 confers docetaxel chemoresistance of breast cancer cells via regulation of EIF4E expression. Oncol Rep. 2015 May;33(5):2504-12. doi: 10.3892/or.2015.3866. Epub 2015 Mar 18.
• Ref 9: miR-141 regulation of EIF4E expression affects docetaxel chemoresistance of non-small cell lung cancer. Oncol Rep. 2017 Jan;37(1):608-616. doi: 10.3892/or.2016.5214. Epub 2016 Nov 2.
• Ref 10: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 11: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 12: MicroRNA-141 inhibits tumor growth and minimizes therapy resistance in colorectal cancer. Mol Med Rep. 2017 Mar;15(3):1037-1042. doi: 10.3892/mmr.2017.6135. Epub 2017 Jan 23.
• Ref 13: lncRNA KRAL reverses 5-fluorouracil resistance in hepatocellular carcinoma cells by acting as a ceRNA against miR-141. Cell Commun Signal. 2018 Aug 17;16(1):47. doi: 10.1186/s12964-018-0260-z.
• Ref 14: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 15: miR-200/ZEB axis regulates sensitivity to nintedanib in non-small cell lung cancer cells. Int J Oncol. 2016 Mar;48(3):937-44. doi: 10.3892/ijo.2016.3331. Epub 2016 Jan 11.
• Ref 16: Carcinoma-associated fibroblasts promote the stemness and chemoresistance of colorectal cancer by transferring exosomal lncRNA H19. Theranostics. 2018 Jun 24;8(14):3932-3948. doi: 10.7150/thno.25541. eCollection 2018.
• Ref 17: Overexpression of MEG3 sensitizes colorectal cancer cells to oxaliplatin through regulation of miR-141/PDCD4 axis. Biomed Pharmacother. 2018 Oct;106:1607-1615. doi: 10.1016/j.biopha.2018.07.131. Epub 2018 Jul 29.
• Ref 18: A possible role for microRNA-141 down-regulation in sunitinib resistant metastatic clear cell renal cell carcinoma through induction of epithelial-to-mesenchymal transition and hypoxia resistance. J Urol. 2013 May;189(5):1930-8. doi: 10.1016/j.juro.2012.11.133. Epub 2012 Nov 30.
• Ref 19: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 20: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.