General Information of the Molecule (ID: Mol01414)
Name
hsa-mir-122 ,Homo sapiens
Synonyms
microRNA 122
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR122
Gene ID
406906
Location
chr18:58451074-58451158[+]
Sequence
CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUA
UCACACUAAAUAGCUACUGCUAGGC
    Click to Show/Hide
Ensembl ID
ENSG00000284440
HGNC ID
HGNC:31501
Precursor Accession
MI0000442
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bortezomib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cutaneous T-cell lymphomas [ICD-11: 2B00.0] [1]
Resistant Disease Cutaneous T-cell lymphomas [ICD-11: 2B00.0]
Resistant Drug Bortezomib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation p53/AKT Signalling Regulation N.A.
In Vitro Model MyLa2000 cells Skin Homo sapiens (Human) CVCL_8328
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Flow cytometry assays
Mechanism Description We found that miR-122 was significantly increased in the apoptotic cells. miR-122 up-regulation was not specific for GSI-1 but was also seen during apoptosis induced by chemotherapies including doxorubicin and proteasome blockers (bortezomib, MG132). miR-122 was not expressed in quiescent T-cells, but was detectable in CTCL: in lesional skin in mycosis fungoides and in Sezary cells purified from peripheral blood. In situ hybridization results showed that miR-122 was expressed in the malignant T-cell infiltrate and increased in the advanced stage mycosis fungoides. Surprisingly, miR-122 overexpression decreased the sensitivity to the chemotherapy-induced apoptosis via a signaling circuit involving the activation of Akt and inhibition of p53. We have also shown that induction of miR-122 occurred via p53 and that p53 post-transcriptionally up-regulated miR-122. miR-122 is thus an amplifier of the antiapoptotic Akt/p53 circuit and it is conceivable that a pharmacological intervention in this pathway may provide basis for novel therapies for CTCL.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow Cytometric Analysis
Mechanism Description Transfection of miR122 mimics into cultured HepG2 cells induces cell-cycle arrest and sensitizes these cells to doxorubicin by modulating the expression of multidrug resistance genes, ABCB1 and ABCF2.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [3]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
miR122/PKM2 signaling pathway Regulation N.A.
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC cells Liver Homo sapiens (Human) CVCL_0485
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-122 in Huh7/R cells reversed the doxorubicin-resistance through the inhibition of PkM2, inducing the apoptosis in doxorubicin-resistant cancer cells.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Overexpression of miR-122 could modulate the sensitivity of the HCC cells to chemotherapeutic drugs through downregulating MDR related genes MDR-1, GST-Pi, and MRP, antiapoptotic gene Bcl-w and cell cycle related gene cyclin B1.
Disease Class: Hepatocellular cancer [ICD-11: 2C12.4] [5]
Sensitive Disease Hepatocellular cancer [ICD-11: 2C12.4]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
p53 signaling pathway Activation hsa04115
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Annexin V/propidium iodide detection kit
Mechanism Description miR-122 enforced expression, as well as cyclin G1 silencing, leads to increased p53 protein stability and transcriptional activity and reduced invasion capability of HCC-derived cell lines, miR-122, through down-regulation of cyclin G1, can trigger apoptosis and increase sensitivity of HCC-derived cells to doxorubicin.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatic carcinoma [ICD-11: 2C12.3] [6]
Resistant Disease Hepatic carcinoma [ICD-11: 2C12.3]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR122/PCDH20/AKT/mTOR signaling pathway Activation hsa05206
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
SNU449 cells Liver Homo sapiens (Human) CVCL_0454
MHCC97 cells Liver Homo sapiens (Human) CVCL_4971
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; RT-qPCR
Experiment for
Drug Resistance
MTT assay; CellTiter 96 Aqueous One Solution cell proliferation assay
Mechanism Description Targeting PCDH20 gene by microRNA-122 confers 5-FU resistance in hepatic carcinoma. Rescue of PCDH20 expression in miR122-expressing cells decreases Akt and mTOR phosphorylation, re-sensitizing hepatocellular carcinoma cell to 5-fluorouracil induced apoptosis.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [7]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-122 inhibits MDR1 expression via suppression of Wnt/beta-catenin pathway, thereby enhancing HCC sensitivity to OXA.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description The recovery of miR-122 expression can sensitize SW480/OR and HT29/OR cells to oxaliplatin-mediated apoptosis through the inhibition of XIAP expression.
Sorafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [9]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
In Vivo Model DEN-HCC mouse model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-122 overexpression increased sorafenib sensitivity in treated cells via downregulating SerpinB3 expression.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [10]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
RAS/RAF/ERK signaling pathway Inhibition hsa04010
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
T1115 cells Liver Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay;
Mechanism Description Overexpression of miR-122 made drug-tolerant cells sensitive to sorafenib and induced apoptosis. Insulin-like growth factor 1 receptor (IGF-1R) was validated as a target of miR-122 and was repressed by this miRNA. miR-122-induced apoptosis was repressed by the IGF-1R activator IGFI or IGFII. Conversely, the IGF-1R inhibitor PPP or NVP-AEW541 in combination with sorafenib significantly induced cell apoptosis and disrupted tolerance to drugs in vitro. These results indicated that activation of IGF-1R by ectopic down-regulation of miR-122 counteracted the effects of sorafenib-induced apoptosis, thus conferring sorafenib resistance.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [11]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Angiogenic potential Inhibition hsa04370
Cell apoptosis Activation hsa04210
Tumorigenic properties Inhibition hsa05200
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description ADAM10 (a distintegrin and metalloprotease family), serum response factor (SRF), and insulin-like growth factor 1 receptor (Igf1R) that promote tumorigenesis were validated as targets of miR-122 and were repressed by the microRNA. Ectopic expression of miR-122 in nonexpressing HepG2, Hep3B, and Sk-Hep-1 cells reversed their tumorigenic properties such as growth, replication potential, clonogenic survival, anchorage-independent growth, migration, invasion, and tumor formation in nude mice.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Overexpression of miR-122 could modulate the sensitivity of the HCC cells to chemotherapeutic drugs through downregulating MDR related genes MDR-1, GST-Pi, and MRP, antiapoptotic gene Bcl-w and cell cycle related gene cyclin B1.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
TRAIL
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [12]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug TRAIL
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model H460 cells Lung Homo sapiens (Human) CVCL_0459
Calu1 cells Lung Homo sapiens (Human) CVCL_0608
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Annexin V staining assay
Mechanism Description PED/PEA-15 has a broad antiapoptotic action, being able to inhibit both the intrinsic and the extrinsic apoptotic pathways. miR-212 negatively modulates PED/PEA-15 expression and sensitizes non-small cell lung cancer (NSCLC) cells to TRAIL-induced apoptosis.
References
Ref 1 CEP-28122, a highly potent and selective orally active inhibitor of anaplastic lymphoma kinase with antitumor activity in experimental models of human cancersMol Cancer Ther. 2012 Mar;11(3):670-9. doi: 10.1158/1535-7163.MCT-11-0776. Epub 2011 Dec 27.
Ref 2 Possible Role of microRNA-122 in Modulating Multidrug Resistance of Hepatocellular Carcinoma. Indian J Clin Biochem. 2018 Jan;33(1):21-30. doi: 10.1007/s12291-017-0651-8. Epub 2017 Apr 21.
Ref 3 MiR-122 Reverses the Doxorubicin-Resistance in Hepatocellular Carcinoma Cells through Regulating the Tumor Metabolism. PLoS One. 2016 May 3;11(5):e0152090. doi: 10.1371/journal.pone.0152090. eCollection 2016.
Ref 4 MicroRNA-122 sensitizes HCC cancer cells to adriamycin and vincristine through modulating expression of MDR and inducing cell cycle arrest. Cancer Lett. 2011 Nov 28;310(2):160-9. doi: 10.1016/j.canlet.2011.06.027. Epub 2011 Jul 2.
Ref 5 MiR-122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2009 Jul 15;69(14):5761-7. doi: 10.1158/0008-5472.CAN-08-4797. Epub 2009 Jul 7.
Ref 6 Targeting PCDH20 gene by microRNA-122 confers 5-FU resistance in hepatic carcinoma. Am J Cancer Res. 2016 Aug 1;6(8):1681-94. eCollection 2016.
Ref 7 miR-122 enhances sensitivity of hepatocellular carcinoma to oxaliplatin via inhibiting MDR1 by targeting Wnt/Beta-catenin pathway. Exp Mol Pathol. 2019 Feb;106:34-43. doi: 10.1016/j.yexmp.2018.10.009. Epub 2018 Oct 26.
Ref 8 miR-122 Targets X-Linked Inhibitor of Apoptosis Protein to Sensitize Oxaliplatin-Resistant Colorectal Cancer Cells to Oxaliplatin-Mediated Cytotoxicity. Cell Physiol Biochem. 2018;51(5):2148-2159. doi: 10.1159/000495832. Epub 2018 Dec 6.
Ref 9 MiR-122 Targets SerpinB3 and Is Involved in Sorafenib Resistance in Hepatocellular Carcinoma. J Clin Med. 2019 Feb 1;8(2):171. doi: 10.3390/jcm8020171.
Ref 10 MicroRNA-122 confers sorafenib resistance to hepatocellular carcinoma cells by targeting IGF-1R to regulate RAS/RAF/ERK signaling pathways. Cancer Lett. 2016 Feb 28;371(2):171-81. doi: 10.1016/j.canlet.2015.11.034. Epub 2015 Dec 3.
Ref 11 MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009 Nov 13;284(46):32015-27. doi: 10.1074/jbc.M109.016774. Epub 2009 Sep 2.
Ref 12 miR-212 increases tumor necrosis factor-related apoptosis-inducing ligand sensitivity in non-small cell lung cancer by targeting the antiapoptotic protein PED. Cancer Res. 2010 May 1;70(9):3638-46. doi: 10.1158/0008-5472.CAN-09-3341. Epub 2010 Apr 13.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.