Molecule Information
General Information of the Molecule (ID: Mol01414)
| Name |
hsa-mir-122
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 122
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR122
|
||||
| Gene ID | |||||
| Location |
chr18:58451074-58451158[+]
|
||||
| Sequence |
CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUA
UCACACUAAAUAGCUACUGCUAGGC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cutaneous T-cell lymphomas [ICD-11: 2B00.0] | [1] | |||
| Resistant Disease | Cutaneous T-cell lymphomas [ICD-11: 2B00.0] | |||
| Resistant Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | p53/AKT Signalling | Regulation | N.A. | |
| In Vitro Model | MyLa2000 cells | Skin | Homo sapiens (Human) | CVCL_8328 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Flow cytometry assays | |||
| Mechanism Description | We found that miR-122 was significantly increased in the apoptotic cells. miR-122 up-regulation was not specific for GSI-1 but was also seen during apoptosis induced by chemotherapies including doxorubicin and proteasome blockers (bortezomib, MG132). miR-122 was not expressed in quiescent T-cells, but was detectable in CTCL: in lesional skin in mycosis fungoides and in Sezary cells purified from peripheral blood. In situ hybridization results showed that miR-122 was expressed in the malignant T-cell infiltrate and increased in the advanced stage mycosis fungoides. Surprisingly, miR-122 overexpression decreased the sensitivity to the chemotherapy-induced apoptosis via a signaling circuit involving the activation of Akt and inhibition of p53. We have also shown that induction of miR-122 occurred via p53 and that p53 post-transcriptionally up-regulated miR-122. miR-122 is thus an amplifier of the antiapoptotic Akt/p53 circuit and it is conceivable that a pharmacological intervention in this pathway may provide basis for novel therapies for CTCL. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow Cytometric Analysis | |||
| Mechanism Description | Transfection of miR122 mimics into cultured HepG2 cells induces cell-cycle arrest and sensitizes these cells to doxorubicin by modulating the expression of multidrug resistance genes, ABCB1 and ABCF2. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [3] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| miR122/PKM2 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR-122 in Huh7/R cells reversed the doxorubicin-resistance through the inhibition of PkM2, inducing the apoptosis in doxorubicin-resistant cancer cells. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [4] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Overexpression of miR-122 could modulate the sensitivity of the HCC cells to chemotherapeutic drugs through downregulating MDR related genes MDR-1, GST-Pi, and MRP, antiapoptotic gene Bcl-w and cell cycle related gene cyclin B1. | |||
| Disease Class: Hepatocellular cancer [ICD-11: 2C12.4] | [5] | |||
| Sensitive Disease | Hepatocellular cancer [ICD-11: 2C12.4] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Annexin V/propidium iodide detection kit | |||
| Mechanism Description | miR-122 enforced expression, as well as cyclin G1 silencing, leads to increased p53 protein stability and transcriptional activity and reduced invasion capability of HCC-derived cell lines, miR-122, through down-regulation of cyclin G1, can trigger apoptosis and increase sensitivity of HCC-derived cells to doxorubicin. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatic carcinoma [ICD-11: 2C12.3] | [6] | |||
| Resistant Disease | Hepatic carcinoma [ICD-11: 2C12.3] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | miR122/PCDH20/AKT/mTOR signaling pathway | Activation | hsa05206 | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
| MHCC97 cells | Liver | Homo sapiens (Human) | CVCL_4971 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR; RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; CellTiter 96 Aqueous One Solution cell proliferation assay | |||
| Mechanism Description | Targeting PCDH20 gene by microRNA-122 confers 5-FU resistance in hepatic carcinoma. Rescue of PCDH20 expression in miR122-expressing cells decreases Akt and mTOR phosphorylation, re-sensitizing hepatocellular carcinoma cell to 5-fluorouracil induced apoptosis. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [7] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 | |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-122 inhibits MDR1 expression via suppression of Wnt/beta-catenin pathway, thereby enhancing HCC sensitivity to OXA. | |||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [8] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | The recovery of miR-122 expression can sensitize SW480/OR and HT29/OR cells to oxaliplatin-mediated apoptosis through the inhibition of XIAP expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [9] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| In Vivo Model | DEN-HCC mouse model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-122 overexpression increased sorafenib sensitivity in treated cells via downregulating SerpinB3 expression. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [10] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| RAS/RAF/ERK signaling pathway | Inhibition | hsa04010 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| T1115 cells | Liver | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay; | |||
| Mechanism Description | Overexpression of miR-122 made drug-tolerant cells sensitive to sorafenib and induced apoptosis. Insulin-like growth factor 1 receptor (IGF-1R) was validated as a target of miR-122 and was repressed by this miRNA. miR-122-induced apoptosis was repressed by the IGF-1R activator IGFI or IGFII. Conversely, the IGF-1R inhibitor PPP or NVP-AEW541 in combination with sorafenib significantly induced cell apoptosis and disrupted tolerance to drugs in vitro. These results indicated that activation of IGF-1R by ectopic down-regulation of miR-122 counteracted the effects of sorafenib-induced apoptosis, thus conferring sorafenib resistance. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [11] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Angiogenic potential | Inhibition | hsa04370 | |
| Cell apoptosis | Activation | hsa04210 | ||
| Tumorigenic properties | Inhibition | hsa05200 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | ADAM10 (a distintegrin and metalloprotease family), serum response factor (SRF), and insulin-like growth factor 1 receptor (Igf1R) that promote tumorigenesis were validated as targets of miR-122 and were repressed by the microRNA. Ectopic expression of miR-122 in nonexpressing HepG2, Hep3B, and Sk-Hep-1 cells reversed their tumorigenic properties such as growth, replication potential, clonogenic survival, anchorage-independent growth, migration, invasion, and tumor formation in nude mice. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [4] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Overexpression of miR-122 could modulate the sensitivity of the HCC cells to chemotherapeutic drugs through downregulating MDR related genes MDR-1, GST-Pi, and MRP, antiapoptotic gene Bcl-w and cell cycle related gene cyclin B1. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [12] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 |
| Calu1 cells | Lung | Homo sapiens (Human) | CVCL_0608 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Annexin V staining assay | |||
| Mechanism Description | PED/PEA-15 has a broad antiapoptotic action, being able to inhibit both the intrinsic and the extrinsic apoptotic pathways. miR-212 negatively modulates PED/PEA-15 expression and sensitizes non-small cell lung cancer (NSCLC) cells to TRAIL-induced apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
