General Information of the Molecule (ID: Mol01405)
Name
hsa-mir-223 ,Homo sapiens
Synonyms
microRNA 223
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR223
Gene ID
407008
Location
chrX:66018870-66018979[+]
Sequence
CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCAUGU
GGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGCGGCACAUGCUUACCAG
    Click to Show/Hide
Ensembl ID
ENSG00000284567
HGNC ID
HGNC:31603
Precursor Accession
MI0000300
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR; Luciferase report assay
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description On the basis of these findings, we propose that one of the pathways affected by mutant p53 to increase cellular resistance to chemotherapeutic agents involves miR-223 downregulation and the consequent upregulation of STMN-1.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
IGF1R/AKT/PI3K signaling pathway Activation hsa05224
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCI-H292 cells Lung Homo sapiens (Human) CVCL_0455
NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-H838 cells Lung Homo sapiens (Human) CVCL_1594
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Long non-coding RNA EGFR-AS1 Can enhance IGF1R expression by suppressing miR-223 expression to promotes cisplatin resistance in the non-small cell lung cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; FITC-Annexin V and PI staining assay; Flow cytometry assay
Mechanism Description microRNA-223 increases the sensitivity of triple-negative breast cancer stem cells to TRAIL-induced apoptosis by targeting HAX-1.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
JNk signaling pathway Activation hsa04010
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
HOS cells Bone Homo sapiens (Human) CVCL_0312
Sk-ES-1 cells Bone Homo sapiens (Human) CVCL_0627
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-223 overexpression could sensitize OS cell lines to CDDP and Hsp70 protein levels were remarkably reduced by miR-223 overexpression whereas increased by miR-223 inhibition.
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [5]
Sensitive Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model OE33 cellss Esophagus Homo sapiens (Human) CVCL_0471
HEEpiC cells Esophagus Homo sapiens (Human) N.A.
JHesoAD1 cells Esophagus Homo sapiens (Human) CVCL_8098
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gallbladder cancer [ICD-11: 2C13.0] [6]
Sensitive Disease Gallbladder cancer [ICD-11: 2C13.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model GBC-SD cells Gallbladder Homo sapiens (Human) CVCL_6903
NOZ cells Gallbladder Homo sapiens (Human) CVCL_3079
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR223 increases gallbladder cancer cell sensitivity to docetaxel by downregulating STMN1.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; FITC-Annexin V and PI staining assay; Flow cytometry assay
Mechanism Description microRNA-223 increases the sensitivity of triple-negative breast cancer stem cells to TRAIL-induced apoptosis by targeting HAX-1.
Disease Class: Breast cancer [ICD-11: 2C60.3] [7]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell Death assay
Mechanism Description miR-223 Impairs Tumor Cell Migration and Invasion, miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs (Doxorubicin and Paclitaxel), miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A, Down-modulation of STAT5A Accounts for miR-223 Biological Effects.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [8]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
HCC3 cells Liver Homo sapiens (Human) CVCL_0C57
LM-6 cells Liver Homo sapiens (Human) CVCL_7680
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description miR-223 targeted ABCB1 3'UTR directly, and miR-223 down-regulated ABCB1 at both mRNA and protein levels. The over-expression of miR-223 increased the HCC cellsensitivity to anticancer drugs, and the inhibition of miR-223 had the opposite effect. Importantly, the over-expression or silencingof ABCB1 can rescue the cell response to the anticancer drugs mediated by miR-223 over-expression or inhibition.
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [5]
Sensitive Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model OE33 cellss Esophagus Homo sapiens (Human) CVCL_0471
HEEpiC cells Esophagus Homo sapiens (Human) N.A.
JHesoAD1 cells Esophagus Homo sapiens (Human) CVCL_8098
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [9]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
miR223/FBXW7 signaling pathway Regulation N.A.
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Overexpression of miR-223 decreased FBXW7 expression and the sensitivity of CRC cells to doxorubicin, while suppression of miR-223 had the opposite effect.
Erlotinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [10]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Notch/miR223/FBXW7 signaling pathway Regulation N.A.
In Vitro Model HCC827 cells Lung Homo sapiens (Human) CVCL_2063
293T cells Breast Homo sapiens (Human) CVCL_0063
HCC827/ER cells Lung Homo sapiens (Human) CVCL_EJ07
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
Mechanism Description Sensitivity of non-small cell lung cancer to erlotinib is regulated by the Notch/miR223/FBXW7 pathway. Blocking either the Akt or Notch signaling pathway and reducing miR223 expression resulted in decreased resistance in HCC827/ER cells, miR223 enhanced resistance to erlotinib by down-regulating FBXW7 expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [11]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
IGF-1R/AKT/S6 signaling pathway Regulation N.A.
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-223 inhibits IGF-1R/Akt/S6 signaling, and this effect is reversed by the exogenous expression of IGF-1. Overexpression of miR-223 enhances the sensitivity of PC-9/ER cells to erlotinib by inducing apoptosis.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
IGF1R/AKT/PI3K signaling pathway Activation hsa05224
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCI-H292 cells Lung Homo sapiens (Human) CVCL_0455
NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
NCI-H838 cells Lung Homo sapiens (Human) CVCL_1594
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Long non-coding RNA EGFR-AS1 Can enhance IGF1R expression by suppressing miR-223 expression to promotes gemcitabine resistance in the non-small cell lung cancer.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [12]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Transwell migration and invasion assay
Mechanism Description Down-regulation of miR-223 reverses epithelial-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells due to down-regulation of its target Fbw7 and subsequent upregulation of Notch-1, which enhances GR cells to gemcitabine sensitivity.
Mitomycin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [5]
Sensitive Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
Sensitive Drug Mitomycin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model OE33 cellss Esophagus Homo sapiens (Human) CVCL_0471
HEEpiC cells Esophagus Homo sapiens (Human) N.A.
JHesoAD1 cells Esophagus Homo sapiens (Human) CVCL_8098
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [7]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell Death assay
Mechanism Description miR-223 Impairs Tumor Cell Migration and Invasion, miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs (Doxorubicin and Paclitaxel), miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A, Down-modulation of STAT5A Accounts for miR-223 Biological Effects.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [8]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
HCC3 cells Liver Homo sapiens (Human) CVCL_0C57
LM-6 cells Liver Homo sapiens (Human) CVCL_7680
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description miR-223 targeted ABCB1 3'UTR directly, and miR-223 down-regulated ABCB1 at both mRNA and protein levels. The over-expression of miR-223 increased the HCC cellsensitivity to anticancer drugs, and the inhibition of miR-223 had the opposite effect. Importantly, the over-expression or silencingof ABCB1 can rescue the cell response to the anticancer drugs mediated by miR-223 over-expression or inhibition.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [13]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Transwell assay; Transwell matrix penetration assay; MTT assay; BrdU incorporation assay
Mechanism Description miR223/PAX6 axis regulates glioblastoma stem cell proliferation and the chemo resistance to TMZ via inhibition of PI3k/Akt pathway.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [14]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
miR223/FBXW7 signaling pathway Regulation N.A.
In Vitro Model NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
KATO-3 cells Gastric Homo sapiens (Human) CVCL_0371
NUGC3 cells Gastric Homo sapiens (Human) CVCL_1612
NUGC4 cells Gastric Homo sapiens (Human) CVCL_3082
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Overexpression of miR-223 decreased FBXW7 expression and the sensitivity of GC cells to trastuzumab, while suppression of miR-223 restored FBXW7 expression and the sensitivity of GC cells to trastuzumab.
Investigative Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Dapt (Gsi IX)
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute T-cell lymphocytic leukemia [ICD-11: 2A90.5] [15]
Resistant Disease Acute T-cell lymphocytic leukemia [ICD-11: 2A90.5]
Resistant Drug Dapt (Gsi IX)
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
Notch/NF-kB signaling pathway Regulation N.A.
In Vitro Model Jurkat cells Pleural effusion Homo sapiens (Human) CVCL_0065
DND41 cells Pleural effusion Homo sapiens (Human) CVCL_2022
Jurkat IkkGamma -/- cells Pleural effusion Homo sapiens (Human) CVCL_0065
Molt3 cells Pleural effusion Homo sapiens (Human) CVCL_0624
TALL-1 cells Pleural effusion Homo sapiens (Human) CVCL_1736
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Trypan blue staining; MTT assay; Promega assay
Mechanism Description Specific inhibition of miR-223 restores GSI sensitivity in GSI-resistant Molt3 cells carrying wt FBXW7. Therefore, upregulation of FBXW7 through the specific inhibition of miR-223 could offer an attractive targeted therapy for GSI-resistant T-ALLs harboring wt FBXW7 and overexpressing miR-223.
Platinum
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [16]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Resistant Drug Platinum
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Hypoxic TAMs derived exosomes containing miR-223 were internalized by EOC cells and promoted drug resistance of EOC cells and exosmic miR-223 inactivate PI3k/AkT pathway through PTEN targeting.
References
Ref 1 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 2 Overexpression of lncRNA EGFR AS1 is associated with a poor prognosis and promotes chemotherapy resistance in non small cell lung cancer. Int J Oncol. 2019 Jan;54(1):295-305. doi: 10.3892/ijo.2018.4629. Epub 2018 Nov 9.
Ref 3 MicroRNA-223 Increases the Sensitivity of Triple-Negative Breast Cancer Stem Cells to TRAIL-Induced Apoptosis by Targeting HAX-1. PLoS One. 2016 Sep 12;11(9):e0162754. doi: 10.1371/journal.pone.0162754. eCollection 2016.
Ref 4 miR-223/Hsp70/JNK/JUN/miR-223 feedback loop modulates the chemoresistance of osteosarcoma to cisplatin. Biochem Biophys Res Commun. 2018 Mar 11;497(3):827-834. doi: 10.1016/j.bbrc.2018.02.091. Epub 2018 Feb 9.
Ref 5 MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78. doi: 10.1158/1078-0432.CCR-13-0601. Epub 2013 Jun 11.
Ref 6 miR-223 increases gallbladder cancer cell sensitivity to docetaxel by downregulating STMN1. Oncotarget. 2016 Sep 20;7(38):62364-62376. doi: 10.18632/oncotarget.11634.
Ref 7 miR-223 is a coordinator of breast cancer progression as revealed by bioinformatics predictions. PLoS One. 2014 Jan 6;9(1):e84859. doi: 10.1371/journal.pone.0084859. eCollection 2014.
Ref 8 MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32. doi: 10.1177/1535370213497321. Epub 2013 Aug 7.
Ref 9 MiR-223 promotes the doxorubicin resistance of colorectal cancer cells via regulating epithelial-mesenchymal transition by targeting FBXW7. Acta Biochim Biophys Sin (Shanghai). 2018 Jun 1;50(6):597-604. doi: 10.1093/abbs/gmy040.
Ref 10 Sensitivity of non-small cell lung cancer to erlotinib is regulated by the Notch/miR-223/FBXW7 pathway. Biosci Rep. 2017 Jun 21;37(3):BSR20160478. doi: 10.1042/BSR20160478. Print 2017 Jun 30.
Ref 11 miR-223 enhances the sensitivity of non-small cell lung cancer cells to erlotinib by targeting the insulin-like growth factor-1 receptor. Int J Mol Med. 2016 Jul;38(1):183-91. doi: 10.3892/ijmm.2016.2588. Epub 2016 May 13.
Ref 12 Down-regulation of miR-223 reverses epithelial-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Oncotarget. 2015 Jan 30;6(3):1740-9. doi: 10.18632/oncotarget.2714.
Ref 13 MiR-223/PAX6 Axis Regulates Glioblastoma Stem Cell Proliferation and the Chemo Resistance to TMZ via Regulating PI3K/Akt Pathway. J Cell Biochem. 2017 Oct;118(10):3452-3461. doi: 10.1002/jcb.26003. Epub 2017 Jun 6.
Ref 14 The sensitivity of gastric cancer to trastuzumab is regulated by the miR-223/FBXW7 pathway. Int J Cancer. 2015 Apr 1;136(7):1537-45. doi: 10.1002/ijc.29168. Epub 2014 Sep 11.
Ref 15 Notch and NF-kB signaling pathways regulate miR-223/FBXW7 axis in T-cell acute lymphoblastic leukemia. Leukemia. 2014 Dec;28(12):2324-35. doi: 10.1038/leu.2014.133. Epub 2014 Apr 14.
Ref 16 Macrophages derived exosomes deliver miR-223 to epithelial ovarian cancer cells to elicit a chemoresistant phenotype. J Exp Clin Cancer Res. 2019 Feb 15;38(1):81. doi: 10.1186/s13046-019-1095-1.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.