Molecule Information
General Information of the Molecule (ID: Mol01405)
| Name |
hsa-mir-223
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 223
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR223
|
||||
| Gene ID | |||||
| Location |
chrX:66018870-66018979[+]
|
||||
| Sequence |
CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCAUGU
GGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGCGGCACAUGCUUACCAG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| Experiment for Molecule Alteration |
RT-PCR; Luciferase report assay | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | On the basis of these findings, we propose that one of the pathways affected by mutant p53 to increase cellular resistance to chemotherapeutic agents involves miR-223 downregulation and the consequent upregulation of STMN-1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [2] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| IGF1R/AKT/PI3K signaling pathway | Activation | hsa05224 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| NCI-H292 cells | Lung | Homo sapiens (Human) | CVCL_0455 | |
| NCI-H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| NCI-H838 cells | Lung | Homo sapiens (Human) | CVCL_1594 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Long non-coding RNA EGFR-AS1 Can enhance IGF1R expression by suppressing miR-223 expression to promotes cisplatin resistance in the non-small cell lung cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MCF10A cells | Breast | Homo sapiens (Human) | CVCL_0598 | |
| MDA-MB-435 cells | Breast | Homo sapiens (Human) | CVCL_0417 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; FITC-Annexin V and PI staining assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-223 increases the sensitivity of triple-negative breast cancer stem cells to TRAIL-induced apoptosis by targeting HAX-1. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [4] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| JNk signaling pathway | Activation | hsa04010 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| SJSA-1 cells | Bone | Homo sapiens (Human) | CVCL_1697 | |
| HOS cells | Bone | Homo sapiens (Human) | CVCL_0312 | |
| Sk-ES-1 cells | Bone | Homo sapiens (Human) | CVCL_0627 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-223 overexpression could sensitize OS cell lines to CDDP and Hsp70 protein levels were remarkably reduced by miR-223 overexpression whereas increased by miR-223 inhibition. | |||
| Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] | [5] | |||
| Sensitive Disease | Esophageal adenocarcinoma [ICD-11: 2B70.2] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | OE33 cellss | Esophagus | Homo sapiens (Human) | CVCL_0471 |
| HEEpiC cells | Esophagus | Homo sapiens (Human) | N.A. | |
| JHesoAD1 cells | Esophagus | Homo sapiens (Human) | CVCL_8098 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gallbladder cancer [ICD-11: 2C13.0] | [6] | |||
| Sensitive Disease | Gallbladder cancer [ICD-11: 2C13.0] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | GBC-SD cells | Gallbladder | Homo sapiens (Human) | CVCL_6903 |
| NOZ cells | Gallbladder | Homo sapiens (Human) | CVCL_3079 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR223 increases gallbladder cancer cell sensitivity to docetaxel by downregulating STMN1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MCF10A cells | Breast | Homo sapiens (Human) | CVCL_0598 | |
| MDA-MB-435 cells | Breast | Homo sapiens (Human) | CVCL_0417 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; FITC-Annexin V and PI staining assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-223 increases the sensitivity of triple-negative breast cancer stem cells to TRAIL-induced apoptosis by targeting HAX-1. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [7] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cell Death assay | |||
| Mechanism Description | miR-223 Impairs Tumor Cell Migration and Invasion, miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs (Doxorubicin and Paclitaxel), miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A, Down-modulation of STAT5A Accounts for miR-223 Biological Effects. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [8] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 | |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
| HCC3 cells | Liver | Homo sapiens (Human) | CVCL_0C57 | |
| LM-6 cells | Liver | Homo sapiens (Human) | CVCL_7680 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | miR-223 targeted ABCB1 3'UTR directly, and miR-223 down-regulated ABCB1 at both mRNA and protein levels. The over-expression of miR-223 increased the HCC cellsensitivity to anticancer drugs, and the inhibition of miR-223 had the opposite effect. Importantly, the over-expression or silencingof ABCB1 can rescue the cell response to the anticancer drugs mediated by miR-223 over-expression or inhibition. | |||
| Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] | [5] | |||
| Sensitive Disease | Esophageal adenocarcinoma [ICD-11: 2B70.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | OE33 cellss | Esophagus | Homo sapiens (Human) | CVCL_0471 |
| HEEpiC cells | Esophagus | Homo sapiens (Human) | N.A. | |
| JHesoAD1 cells | Esophagus | Homo sapiens (Human) | CVCL_8098 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C. | |||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [9] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
| miR223/FBXW7 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Overexpression of miR-223 decreased FBXW7 expression and the sensitivity of CRC cells to doxorubicin, while suppression of miR-223 had the opposite effect. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [10] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Erlotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Notch/miR223/FBXW7 signaling pathway | Regulation | N.A. | |
| In Vitro Model | HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 |
| 293T cells | Breast | Homo sapiens (Human) | CVCL_0063 | |
| HCC827/ER cells | Lung | Homo sapiens (Human) | CVCL_EJ07 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay | |||
| Mechanism Description | Sensitivity of non-small cell lung cancer to erlotinib is regulated by the Notch/miR223/FBXW7 pathway. Blocking either the Akt or Notch signaling pathway and reducing miR223 expression resulted in decreased resistance in HCC827/ER cells, miR223 enhanced resistance to erlotinib by down-regulating FBXW7 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [11] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Erlotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| IGF-1R/AKT/S6 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-223 inhibits IGF-1R/Akt/S6 signaling, and this effect is reversed by the exogenous expression of IGF-1. Overexpression of miR-223 enhances the sensitivity of PC-9/ER cells to erlotinib by inducing apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [2] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| IGF1R/AKT/PI3K signaling pathway | Activation | hsa05224 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
| NCI-H292 cells | Lung | Homo sapiens (Human) | CVCL_0455 | |
| NCI-H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| NCI-H838 cells | Lung | Homo sapiens (Human) | CVCL_1594 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Long non-coding RNA EGFR-AS1 Can enhance IGF1R expression by suppressing miR-223 expression to promotes gemcitabine resistance in the non-small cell lung cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [12] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Transwell migration and invasion assay | |||
| Mechanism Description | Down-regulation of miR-223 reverses epithelial-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells due to down-regulation of its target Fbw7 and subsequent upregulation of Notch-1, which enhances GR cells to gemcitabine sensitivity. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] | [5] | |||
| Sensitive Disease | Esophageal adenocarcinoma [ICD-11: 2B70.2] | |||
| Sensitive Drug | Mitomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | OE33 cellss | Esophagus | Homo sapiens (Human) | CVCL_0471 |
| HEEpiC cells | Esophagus | Homo sapiens (Human) | N.A. | |
| JHesoAD1 cells | Esophagus | Homo sapiens (Human) | CVCL_8098 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [7] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cell Death assay | |||
| Mechanism Description | miR-223 Impairs Tumor Cell Migration and Invasion, miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs (Doxorubicin and Paclitaxel), miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A, Down-modulation of STAT5A Accounts for miR-223 Biological Effects. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [8] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 | |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
| HCC3 cells | Liver | Homo sapiens (Human) | CVCL_0C57 | |
| LM-6 cells | Liver | Homo sapiens (Human) | CVCL_7680 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | miR-223 targeted ABCB1 3'UTR directly, and miR-223 down-regulated ABCB1 at both mRNA and protein levels. The over-expression of miR-223 increased the HCC cellsensitivity to anticancer drugs, and the inhibition of miR-223 had the opposite effect. Importantly, the over-expression or silencingof ABCB1 can rescue the cell response to the anticancer drugs mediated by miR-223 over-expression or inhibition. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [13] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Transwell assay; Transwell matrix penetration assay; MTT assay; BrdU incorporation assay | |||
| Mechanism Description | miR223/PAX6 axis regulates glioblastoma stem cell proliferation and the chemo resistance to TMZ via inhibition of PI3k/Akt pathway. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [14] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| miR223/FBXW7 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| KATO-3 cells | Gastric | Homo sapiens (Human) | CVCL_0371 | |
| NUGC3 cells | Gastric | Homo sapiens (Human) | CVCL_1612 | |
| NUGC4 cells | Gastric | Homo sapiens (Human) | CVCL_3082 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-223 decreased FBXW7 expression and the sensitivity of GC cells to trastuzumab, while suppression of miR-223 restored FBXW7 expression and the sensitivity of GC cells to trastuzumab. | |||
Investigative Drug(s)
2 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute T-cell lymphocytic leukemia [ICD-11: 2A90.5] | [15] | |||
| Resistant Disease | Acute T-cell lymphocytic leukemia [ICD-11: 2A90.5] | |||
| Resistant Drug | Dapt (Gsi IX) | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| Notch/NF-kB signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Jurkat cells | Pleural effusion | Homo sapiens (Human) | CVCL_0065 |
| DND41 cells | Pleural effusion | Homo sapiens (Human) | CVCL_2022 | |
| Jurkat IkkGamma -/- cells | Pleural effusion | Homo sapiens (Human) | CVCL_0065 | |
| Molt3 cells | Pleural effusion | Homo sapiens (Human) | CVCL_0624 | |
| TALL-1 cells | Pleural effusion | Homo sapiens (Human) | CVCL_1736 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Trypan blue staining; MTT assay; Promega assay | |||
| Mechanism Description | Specific inhibition of miR-223 restores GSI sensitivity in GSI-resistant Molt3 cells carrying wt FBXW7. Therefore, upregulation of FBXW7 through the specific inhibition of miR-223 could offer an attractive targeted therapy for GSI-resistant T-ALLs harboring wt FBXW7 and overexpressing miR-223. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [16] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Platinum | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Hypoxic TAMs derived exosomes containing miR-223 were internalized by EOC cells and promoted drug resistance of EOC cells and exosmic miR-223 inactivate PI3k/AkT pathway through PTEN targeting. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
