General Information of the Molecule (ID: Mol01397)
Name
hsa-mir-214 ,Homo sapiens
Synonyms
microRNA 214
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR214
Gene ID
406996
Location
chr1:172138798-172138907[-]
Sequence
GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCC
GCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU
    Click to Show/Hide
Ensembl ID
ENSG00000283844
HGNC ID
HGNC:31591
Precursor Accession
MI0000290
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
13 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Tongue squamous cell carcinoma [ICD-11: 2B62.1] [1]
Resistant Disease Tongue squamous cell carcinoma [ICD-11: 2B62.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-214 can induce cell survival and cisplatin resistance through targeting the 3'-untranslated region (UTR) of the PTEN, which leads to down-regulation of PTEN protein and activation of Akt pathway.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
OV119 cells Ovary Homo sapiens (Human) N.A.
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
Experiment for
Molecule Alteration
qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-214 induces cell survival and cisplatin resistance through targeting the 3'-untranslated region (UTR) of the PTEN, which leads to down-regulation of PTEN protein and activation of Akt pathway. Inhibition of Akt using Akt inhibitor, API-2/triciribine, or introduction of PTEN cDNA lacking 3'-UTR largely abrogates miR-214-induced cell survival. These findings indicate that deregulation of miRNAs is a recurrent event in human ovarian cancer and that miR-214 induces cell survival and cisplatin resistance primarily through targeting the PTEN/Akt pathway.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT phosphorylation signaling pathway Inhibition hsa00190
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
RT4 cells Bladder Homo sapiens (Human) CVCL_0036
SV-HUC-1 cells Bladder Homo sapiens (Human) CVCL_3798
T24 cells Bladder Homo sapiens (Human) CVCL_0554
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR 214 reduces chemoresistance by targeting netrin 1 in bladder cancer cell lines and inhibits AkT phosphorylation.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [4]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
C33A cells Uterus Homo sapiens (Human) CVCL_1094
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-214 significantly reduced cell survival and rendered cell sensitivity to cisplatin through inhibiting the anti-apoptotic protein Bcl2l2.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Cervical cancer [ICD-11: 2C77.0] [5]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Chemosensitivity Activation hsa05207
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
C33A cells Uterus Homo sapiens (Human) CVCL_1094
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Wound healing assay; Transwell invasion assay; MTT assay
Mechanism Description miR214 inhibits cell migration, invasion and promotes the drug sensitivity in human cervical cancer by targeting FOXM1. FOXM1 overexpression counteracts miR214 in cervical cancer, overexpression of FOXM1 reversed the inhibition in cell invasion caused by miR214 as well as the process of EMT, and neutralized the promotion of drug sensitivity to cisplatin that was induced by miR214.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [6]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description MEG3 upregulation can decrease EVs mediated transfer of miR214 in ovarian cancer cells, thereby reducing drug resistance.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [7]
Resistant Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model ECA-109 cells Esophagus Homo sapiens (Human) CVCL_6898
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description High expression of miR-483 and miR-214 might predict less chemotherapy effect. Down-regulation of miR-483 and miR-214 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs to esophageal cancer cells, and it might induce increased accumulation of adriamycin (ADR) and decreased amount of ADR released.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
p53 signaling pathway Activation hsa04115
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
MDA-MB-157 cells Breast Homo sapiens (Human) CVCL_0618
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
WST-8 cell viability assay; CCK8 assay; Flow cytometry assay
Mechanism Description miR-214 promotes apoptosis and sensitizes breast cancer cells to doxorubicin by targeting the RFWD2-p53 cascade.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [9]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HCC827 cells Lung Homo sapiens (Human) CVCL_2063
HCC827/ER cells Lung Homo sapiens (Human) CVCL_EJ07
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Transwell invasion assay; MTS assay
Mechanism Description Down-regulation of miR214 reverses erlotinib resistance in non-small-cell lung cancer through up-regulating LHX6 expression.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [10]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model LOVO cells Colon Homo sapiens (Human) CVCL_0399
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; TUNEL assay
Mechanism Description miR-214 targeted heat shock protein 27 and could sensitize non-resistant colon cancer cells and 5-FU-resistant colon cancer cellsto 5-FU while overexpression of Hsp27 could block miR-214 with an effect on the sensitivity of colon cancer cells to 5-FU.
Fulvestrant
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Fulvestrant
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
PI3K/AKT/mTOR signaling pathway Activation hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description TAM and FUL treatment induced apoptosis as well as autophagy in the ER+ breast cancer cells. Autophagy is a major cause of resistance to TAM and FUL. miR-214 increased the sensitivity of breast cancers to TAM and FUL through inhibition of autophagy by targeting UCP2.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [12]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-214 level was upregulated in gefitinib-resistant PC-9GR cells and their derived exosomes while anti-apoptotic protein of bcl-2 is uoregulated.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [13]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PTEN/AKT signaling pathway Activation hsa05235
In Vitro Model 293T cells Breast Homo sapiens (Human) CVCL_0063
NCI-HCC827 cells Lung Homo sapiens (Human) CVCL_2063
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The knockdown of miR-214 resulted in not only PTEN un-regulation, but also the inactivation of p-AkT. This evidence indicated that miR-214 could regulate PTEN/AkT signaling pathway in EGFR mutant NSCLC cells. Furthermore, the knockdown of miR-214 re-sensitized HCC827/GR to gefitinib. Taken together, these evidences suggested that miR-214 may regulate the acquired resistance to gefinib in EGFR mutant cell lines by targeting PTEN/AkT signaling pathway.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [14]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Ibrutinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [15]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Ibrutinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description microRNA-214 targets PTk6 to inhibit tumorigenic potential and increase drug sensitivity of prostate cancer cells.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [16]
Resistant Disease Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
Resistant Drug Imatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model GIST882 cells Gastric Homo sapiens (Human) CVCL_7044
GIST48 cells Gastric Homo sapiens (Human) CVCL_7041
In Vivo Model GIST patients Homo sapiens
Experiment for
Molecule Alteration
RT-qPCR; Western blot
Experiment for
Drug Resistance
Cytotoxicity assay
Mechanism Description Functionally, miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous KIT mutation but not in GIST48 cells with double KIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [17]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HLE cells Liver Homo sapiens (Human) CVCL_1281
Experiment for
Molecule Alteration
Western blot; RT-PCR; Luciferase assays
Experiment for
Drug Resistance
MTT assay
Mechanism Description In situ analysis revealed that UCP2 is a putative target of miR-214 miR-214 expression is significantly down-regulated in HCC patient samples as compared with normal adjacent tissues and in cell line, human hepatoblastoma cells (HuH6), with high UCP2 protein expression
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] [18]
Sensitive Disease Laryngeal carcinoma [ICD-11: 2C23.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Microarray analysis; qRT-PCR
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description The possible mechanism by which ER-associated genes mediate paclitaxel sensitivity is in that ER is associated with the microtubule cytoskeleton, exactly site where paclitaxel exerts its cytotoxic effect in cancer cells.
Tamoxifen
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
PI3K/AKT/mTOR signaling pathway Activation hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description TAM and FUL treatment induced apoptosis as well as autophagy in the ER+ breast cancer cells. Autophagy is a major cause of resistance to TAM and FUL. miR-214 increased the sensitivity of breast cancers to TAM and FUL through inhibition of autophagy by targeting UCP2.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [20]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK signalling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010 Apr;46(4):317-22. doi: 10.1016/j.oraloncology.2010.02.002. Epub 2010 Mar 9.
Ref 2 MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Cancer Res. 2008 Jan 15;68(2):425-33. doi: 10.1158/0008-5472.CAN-07-2488.
Ref 3 miR 214 reduces cisplatin resistance by targeting netrin 1 in bladder cancer cells. Int J Mol Med. 2018 Mar;41(3):1765-1773. doi: 10.3892/ijmm.2018.3374. Epub 2018 Jan 10.
Ref 4 MiR-214 reduces cell survival and enhances cisplatin-induced cytotoxicity via down-regulation of Bcl2l2 in cervical cancer cells. FEBS Lett. 2013 Mar 1;587(5):488-95. doi: 10.1016/j.febslet.2013.01.016. Epub 2013 Jan 18.
Ref 5 MiR-214 inhibits cell migration, invasion and promotes the drug sensitivity in human cervical cancer by targeting FOXM1. Am J Transl Res. 2017 Aug 15;9(8):3541-3557. eCollection 2017.
Ref 6 Curcumin suppresses cisplatin resistance development partly via modulating extracellular vesicle-mediated transfer of MEG3 and miR-214 in ovarian cancer. Cancer Chemother Pharmacol. 2017 Mar;79(3):479-487. doi: 10.1007/s00280-017-3238-4. Epub 2017 Feb 8.
Ref 7 Prediction value of miR-483 and miR-214 in prognosis and multidrug resistance of esophageal squamous cell carcinoma. Genet Test Mol Biomarkers. 2013 Jun;17(6):470-4. doi: 10.1089/gtmb.2012.0518. Epub 2013 May 13.
Ref 8 miR-214 promotes apoptosis and sensitizes breast cancer cells to doxorubicin by targeting the RFWD2-p53 cascade. Biochem Biophys Res Commun. 2016 Sep 9;478(1):337-342. doi: 10.1016/j.bbrc.2016.07.054. Epub 2016 Jul 12.
Ref 9 Down-regulation of miR-214 reverses erlotinib resistance in non-small-cell lung cancer through up-regulating LHX6 expression. Sci Rep. 2017 Apr 10;7(1):781. doi: 10.1038/s41598-017-00901-6.
Ref 10 MiR-214 sensitizes human colon cancer cells to 5-FU by targeting Hsp27. Cell Mol Biol Lett. 2019 Mar 14;24:22. doi: 10.1186/s11658-019-0143-3. eCollection 2019.
Ref 11 MiR-214 increases the sensitivity of breast cancer cells to tamoxifen and fulvestrant through inhibition of autophagy. Mol Cancer. 2015 Dec 15;14:208. doi: 10.1186/s12943-015-0480-4.
Ref 12 Exosomal transfer of miR-214 mediates gefitinib resistance in non-small cell lung cancer. Biochem Biophys Res Commun. 2018 Dec 9;507(1-4):457-464. doi: 10.1016/j.bbrc.2018.11.061. Epub 2018 Nov 17.
Ref 13 MicroRNA-214 regulates the acquired resistance to gefitinib via the PTEN/AKT pathway in EGFR-mutant cell lines. Asian Pac J Cancer Prev. 2012;13(1):255-60. doi: 10.7314/apjcp.2012.13.1.255.
Ref 14 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 15 MicroRNA-214 targets PTK6 to inhibit tumorigenic potential and increase drug sensitivity of prostate cancer cells. Sci Rep. 2019 Jul 5;9(1):9776. doi: 10.1038/s41598-019-46170-3.
Ref 16 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 17 Intermittent High-Dose Scheduling of AZD8835, a Novel Selective Inhibitor of PI3KAlpha and PI3K Delta, Demonstrates Treatment Strategies for PIK3CA-Dependent Breast CancersMol Cancer Ther. 2016 May;15(5):877-89. doi: 10.1158/1535-7163.MCT-15-0687. Epub 2016 Feb 2.
Ref 18 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 19 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 20 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.