Molecule Information
General Information of the Molecule (ID: Mol01397)
Name |
hsa-mir-214
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 214
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR214
|
||||
Gene ID | |||||
Location |
chr1:172138798-172138907[-]
|
||||
Sequence |
GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCC
GCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Tongue squamous cell carcinoma | [1] | |||
Resistant Disease | Tongue squamous cell carcinoma [ICD-11: 2B62.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-214 can induce cell survival and cisplatin resistance through targeting the 3'-untranslated region (UTR) of the PTEN, which leads to down-regulation of PTEN protein and activation of Akt pathway. | |||
Disease Class: Ovarian cancer | [2] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | A2780CP cells | Ovary | Homo sapiens (Human) | CVCL_0135 |
OV119 cells | Ovary | Homo sapiens (Human) | N.A. | |
A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 | |
Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-214 induces cell survival and cisplatin resistance through targeting the 3'-untranslated region (UTR) of the PTEN, which leads to down-regulation of PTEN protein and activation of Akt pathway. Inhibition of Akt using Akt inhibitor, API-2/triciribine, or introduction of PTEN cDNA lacking 3'-UTR largely abrogates miR-214-induced cell survival. These findings indicate that deregulation of miRNAs is a recurrent event in human ovarian cancer and that miR-214 induces cell survival and cisplatin resistance primarily through targeting the PTEN/Akt pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [3] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | AKT phosphorylation signaling pathway | Inhibition | hsa00190 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
SV-HUC-1 cells | Bladder | Homo sapiens (Human) | CVCL_3798 | |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR 214 reduces chemoresistance by targeting netrin 1 in bladder cancer cell lines and inhibits AkT phosphorylation. | |||
Disease Class: Cervical cancer | [4] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
C33A cells | Uterus | Homo sapiens (Human) | CVCL_1094 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-214 significantly reduced cell survival and rendered cell sensitivity to cisplatin through inhibiting the anti-apoptotic protein Bcl2l2. | |||
|
||||
Disease Class: Cervical cancer | [5] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
Chemosensitivity | Activation | hsa05207 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 | |
Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
C33A cells | Uterus | Homo sapiens (Human) | CVCL_1094 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Wound healing assay; Transwell invasion assay; MTT assay | |||
Mechanism Description | miR214 inhibits cell migration, invasion and promotes the drug sensitivity in human cervical cancer by targeting FOXM1. FOXM1 overexpression counteracts miR214 in cervical cancer, overexpression of FOXM1 reversed the inhibition in cell invasion caused by miR214 as well as the process of EMT, and neutralized the promotion of drug sensitivity to cisplatin that was induced by miR214. | |||
Disease Class: Ovarian cancer | [6] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | MEG3 upregulation can decrease EVs mediated transfer of miR214 in ovarian cancer cells, thereby reducing drug resistance. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal squamous cell carcinoma | [7] | |||
Resistant Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | High expression of miR-483 and miR-214 might predict less chemotherapy effect. Down-regulation of miR-483 and miR-214 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs to esophageal cancer cells, and it might induce increased accumulation of adriamycin (ADR) and decreased amount of ADR released. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [8] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
p53 signaling pathway | Activation | hsa04115 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
MDA-MB-157 cells | Breast | Homo sapiens (Human) | CVCL_0618 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
WST-8 cell viability assay; CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-214 promotes apoptosis and sensitizes breast cancer cells to doxorubicin by targeting the RFWD2-p53 cascade. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [9] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Erlotinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 |
HCC827/ER cells | Lung | Homo sapiens (Human) | CVCL_EJ07 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Transwell invasion assay; MTS assay | |||
Mechanism Description | Down-regulation of miR214 reverses erlotinib resistance in non-small-cell lung cancer through up-regulating LHX6 expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [10] | |||
Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 |
HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; TUNEL assay | |||
Mechanism Description | miR-214 targeted heat shock protein 27 and could sensitize non-resistant colon cancer cells and 5-FU-resistant colon cancer cellsto 5-FU while overexpression of Hsp27 could block miR-214 with an effect on the sensitivity of colon cancer cells to 5-FU. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [11] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Fulvestrant | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
PI3K/AKT/mTOR signaling pathway | Activation | hsa04151 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | TAM and FUL treatment induced apoptosis as well as autophagy in the ER+ breast cancer cells. Autophagy is a major cause of resistance to TAM and FUL. miR-214 increased the sensitivity of breast cancers to TAM and FUL through inhibition of autophagy by targeting UCP2. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [12] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
In Vitro Model | PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-214 level was upregulated in gefitinib-resistant PC-9GR cells and their derived exosomes while anti-apoptotic protein of bcl-2 is uoregulated. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [13] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PTEN/AKT signaling pathway | Activation | hsa05235 | |
In Vitro Model | 293T cells | Breast | Homo sapiens (Human) | CVCL_0063 |
NCI-HCC827 cells | Lung | Homo sapiens (Human) | CVCL_2063 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | The knockdown of miR-214 resulted in not only PTEN un-regulation, but also the inactivation of p-AkT. This evidence indicated that miR-214 could regulate PTEN/AkT signaling pathway in EGFR mutant NSCLC cells. Furthermore, the knockdown of miR-214 re-sensitized HCC827/GR to gefitinib. Taken together, these evidences suggested that miR-214 may regulate the acquired resistance to gefinib in EGFR mutant cell lines by targeting PTEN/AkT signaling pathway. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic cancer | [14] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [15] | |||
Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Sensitive Drug | Ibrutinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 | |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | microRNA-214 targets PTk6 to inhibit tumorigenic potential and increase drug sensitivity of prostate cancer cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [11] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
PI3K/AKT/mTOR signaling pathway | Activation | hsa04151 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | TAM and FUL treatment induced apoptosis as well as autophagy in the ER+ breast cancer cells. Autophagy is a major cause of resistance to TAM and FUL. miR-214 increased the sensitivity of breast cancers to TAM and FUL through inhibition of autophagy by targeting UCP2. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.