Molecule Information
General Information of the Molecule (ID: Mol01394)
| Name |
hsa-mir-210
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 210
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR210
|
||||
| Gene ID | |||||
| Location |
chr11:568089-568198[-]
|
||||
| Sequence |
ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAG
ACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | [1] | |||
| Sensitive Disease | Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | |||
| Sensitive Drug | Daunorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MLL/AF4+ RS4 cells | Blood | Homo sapiens (Human) | CVCL_0093 |
| TEL/AML1+ Reh cells | Blood | Homo sapiens (Human) | CVCL_ZV66 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter 96 aqueous one solution cell proliferation assay | |||
| Mechanism Description | Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | [1] | |||
| Sensitive Disease | Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | |||
| Sensitive Drug | Dexamethasone | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MLL/AF4+ RS4 cells | Blood | Homo sapiens (Human) | CVCL_0093 |
| TEL/AML1+ Reh cells | Blood | Homo sapiens (Human) | CVCL_ZV66 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter 96 aqueous one solution cell proliferation assay | |||
| Mechanism Description | Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Dual luciferase reporter assay | |||
| Experiment for Drug Resistance |
TUNEL Assay; MTT assay; Flow cytometric analysis | |||
| Mechanism Description | LncRNA CTA-miR210 axis plays an important role in reducing OS chemoresistance. LncRNA CTA could be activated by doxorubicin (DOX), and could promote OS cell apoptosis by competitively binding miR210, while inhibit cell autophagy. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [3] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
| AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
| In Vivo Model | Chick egg xenograft model | Gallus gallus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
RealTime-Glo MT Cell Viability Assay; Caspase-3/7 substrate assay; Colony formation assay | |||
| Mechanism Description | microRNA-210 overexpression inhibits tumor growth and potentially reverses gemcitabine resistance in pancreatic cancer, miR210 is a direct suppressor of the multidrug efflux transporter ABCC5. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | [1] | |||
| Sensitive Disease | Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | |||
| Sensitive Drug | L-asparaginase | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MLL/AF4+ RS4 cells | Blood | Homo sapiens (Human) | CVCL_0093 |
| TEL/AML1+ Reh cells | Blood | Homo sapiens (Human) | CVCL_ZV66 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter 96 aqueous one solution cell proliferation assay | |||
| Mechanism Description | Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [4] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Clonogenic assay | |||
| Mechanism Description | The function of miR-210, which is directly regulated by hypoxia-inducible factor 1-alpha, may also depend on cancer type. miR-210 inhibits apoptosis, bypasses cell-cycle arrest, and promotes cancer cell survival when overexpressed, but when underexpressed, as it is in esophageal squamous cell carcinoma, it represses the initiation of tumor growth by inducing cell death and cell-cycle arrest. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | [1] | |||
| Sensitive Disease | Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MLL/AF4+ RS4 cells | Blood | Homo sapiens (Human) | CVCL_0093 |
| TEL/AML1+ Reh cells | Blood | Homo sapiens (Human) | CVCL_ZV66 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter 96 aqueous one solution cell proliferation assay | |||
| Mechanism Description | Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
