Molecule Information

General Information of the Molecule (ID: Mol01394)

• Name: hsa-mir-210 ,Homo sapiens
• Synonyms: microRNA 210
• Molecule Type: Precursor miRNA
• Gene Name: MIR210
• Gene ID: 406992
• Location: chr11:568089-568198[-]
• Sequence:
  ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAG
  ACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC
• Ensembl ID: ENSG00000199038
• HGNC ID: HGNC:31587
• Precursor Accession: MI0000286

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 14 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: JAK-STAT Signaling Pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Drug-resistant MCF-7/DDP cells had significantly stronger resistance to DDP and a remarkably higher expression level of miR-210 than control parental MCF-7 cells (p < 0.05). After the downregulation of the miR-210 expression, MCF-7/DDP cells had markedly reduced resistance but obviously increased sensitivity to DDP (p < 0.05). MiR-210 downregulation increased the apoptosis of MCF-7/DDP cells (p < 0.05). In addition, after miR-210 was knocked down, the expression level of b-cell lymphoma 2 (Bcl-2) was decreased, while the expression levels of Bcl-2-associated X protein (Bax) and cysteinyl aspartate-specific proteinase-3 (caspase-3) were increased. Besides, miR-210 was able to suppress the expression of protein inhibitor of the activated STAT 4 (PIAS4) gene by directly targeting its 3' untranslated region (3'UTR). The expression of miR-210 has a correlation with chemoresistance of breast cancer MCF-7 cells. MiR-210 regulates the JAK-STAT signal transduction pathway by targeting PIAS4, thus exerting an effect on breast cancer chemosensitivity.

Daunorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] [3]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

Dexamethasone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] [3]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Dexamethasone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Breast cancer patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR
• Mechanism Description: In the validation set, miR-200a (area under the curve = 0.881, sensitivity = 94.1%, specificity = 76.7%) and miR-210 (area under the curve = 0.851, sensitivity = 88.2%, specificity = 72.1%) showed high diagnostic accuracy for distinguishing sensitive group from resistant group. Furthermore, the plasma level of miR-200a was significantly associated with the stage in surgery (P = .035), and the high level of miR-210 expression was associated with internal organ metastasis (liver, lung, and brain; P = .024). Conclusions: Plasma miR-200a and miR-210 could be effective biomarkers for the prediction of chemotherapy resistance in metastatic breast cancer patients.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [5]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Dual luciferase reporter assay
• Experiment for Drug Resistance: TUNEL Assay; MTT assay; Flow cytometric analysis
• Mechanism Description: LncRNA CTA-miR210 axis plays an important role in reducing OS chemoresistance. LncRNA CTA could be activated by doxorubicin (DOX), and could promote OS cell apoptosis by competitively binding miR210, while inhibit cell autophagy.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [6]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vivo Model: Chick egg xenograft model; Gallus gallus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: RealTime-Glo MT Cell Viability Assay; Caspase-3/7 substrate assay; Colony formation assay
• Mechanism Description: microRNA-210 overexpression inhibits tumor growth and potentially reverses gemcitabine resistance in pancreatic cancer, miR210 is a direct suppressor of the multidrug efflux transporter ABCC5.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

L-asparaginase

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] [3]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: L-asparaginase
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [8]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR; Microarrays assay; Gene expression levels analysis
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay
• Mechanism Description: MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [1]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• In Vivo Model: BALB/c nude xenograft model; Mus musculus
• Experiment for Molecule Alteration: Microarray assay; RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Twenty-one differentially expressed miRNAs were found by miRNA microarray between pro- and post-paclitaxel cervical cancer tissues. Increased expression of hsa-mir-210.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [9]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: Water-soluble tetrazolium salt (WST)-based assay
• Mechanism Description: We then performed a comprehensive analysis of miRNA expressions in U251R and parental cells using miRNA microarrays. miR-195, miR-455-3p and miR-10a* were the three most up-regulated miRNAs in the resistant cells. Thirteen miRNAs were overexpressed (>2.0-fold) and two were underexpressed (<0.5-fold) in U251R cells compared to U251Wt cells. In addition, using in silico analysis combined with cDNA microarray experiment, we present possible mRNA targets of these miRNAs.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The function of miR-210, which is directly regulated by hypoxia-inducible factor 1-alpha, may also depend on cancer type. miR-210 inhibits apoptosis, bypasses cell-cycle arrest, and promotes cancer cell survival when overexpressed, but when underexpressed, as it is in esophageal squamous cell carcinoma, it represses the initiation of tumor growth by inducing cell death and cell-cycle arrest.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] [3]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: TEL/AML1+ Reh cells; Blood; Homo sapiens (Human); CVCL_ZV66
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: Functioning as a hypoxamir (i.e. a microRNA whose expression is upregulated by hypoxia), miR-210 targets many genes involved in a wide range of physiological processes, such as cell survival/proliferation, mitochondrial metabolism, protein modification/transport, DNA damage repair and angiogenesis. Increasing/decreasing miR-210 expression using agomir/antagomir could enhance or reduce the response of Reh cells and RS4;11 cells to daunorubicin/dexamethasone/L-asparaginase and daunorubicin/dexamethasone/vincristine, respectively. miR-210 may be a good prognostic factor and a useful predictor of drug sensitivity, and is a potential therapeutic target for pediatric ALL.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 3: Effect of microRNA-210 on prognosis and response to chemotherapeutic drugs in pediatric acute lymphoblastic leukemia. Cancer Sci. 2014 Apr;105(4):463-72. doi: 10.1111/cas.12370. Epub 2014 Mar 30.
• Ref 4: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 5: Long non-coding RNA CTA sensitizes osteosarcoma cells to doxorubicin through inhibition of autophagy. Oncotarget. 2017 May 9;8(19):31465-31477. doi: 10.18632/oncotarget.16356.
• Ref 6: microRNA-210 overexpression inhibits tumor growth and potentially reverses gemcitabine resistance in pancreatic cancer. Cancer Lett. 2017 Mar 1;388:107-117. doi: 10.1016/j.canlet.2016.11.035. Epub 2016 Dec 7.
• Ref 7: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 8: Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
• Ref 9: Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.
• Ref 10: Plasma microRNA 210 levels correlate with sensitivity to trastuzumab and tumor presence in breast cancer patients. Cancer. 2012 May 15;118(10):2603-14. doi: 10.1002/cncr.26565. Epub 2011 Oct 5.