General Information of the Molecule (ID: Mol01393)
Name
hsa-mir-205 ,Homo sapiens
Synonyms
microRNA 205
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR205
Gene ID
406988
Location
chr1:209432133-209432242[+]
Sequence
AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCA
UACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA
    Click to Show/Hide
Ensembl ID
ENSG00000284485
HGNC ID
HGNC:31583
Precursor Accession
MI0000285
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
12 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PTEN signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
Sk-MES-1 cells Lung Homo sapiens (Human) CVCL_0630
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-205 promotes the growth of the NSCLC cell lines, miR-205 is inversely correlated with PTEN expression, miR-205 has the ability to promote growth, migration, invasion and chemoresistance of NSCLC cells by targeting PTEN.
Disease Class: Prostate cancer [ICD-11: 2C82.0] [3]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
RWPE-1 cells Prostate Homo sapiens (Human) CVCL_3791
22RV1 cells Prostate Homo sapiens (Human) CVCL_1045
VCaP cells Prostate Homo sapiens (Human) CVCL_2235
WPE1-NA22 cells Prostate Homo sapiens (Human) CVCL_3810
WPE1-NB11 cells Prostate Homo sapiens (Human) CVCL_3811
WPE1-NB14 cells Prostate Homo sapiens (Human) CVCL_3812
WPE1-NB26 cells Prostate Homo sapiens (Human) CVCL_3813
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-205 and miR-31 regulate apoptosis in prostate cancer cells by targeting antiapoptotic proteins Bcl-w and E2F6.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [4]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell viability Inhibition hsa05200
ERK signaling pathway Inhibition hsa04210
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
VCaP cells Prostate Homo sapiens (Human) CVCL_2235
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description UTMD mediated miR 205 transfection increased the expression of caspase 9, cleaved caspase 9, cytochrome c and E cadherin, and decreased the expression of MMP 9 and p ERk,inhibiting PCa cell proliferation, migration and invasion, and promoted apoptosis modulated by cisplatin.
Disease Class: Prostate cancer [ICD-11: 2C82.0] [5]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
In Vivo Model SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Lysosome disturbance caused by miR-205-mediated down-regulation of RAB27A and LAMP3 constraints the completion of the autophagic flux by compromising the maturation step and, consequently, interferes with the detoxifying capabilities by which PCa cells may become resistant to CDDP.
Cyclophosphamide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PI3K/AKT signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Drug resistance clonogenic assay
Mechanism Description miR-205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [3], [7]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
RWPE-1 cells Prostate Homo sapiens (Human) CVCL_3791
22RV1 cells Prostate Homo sapiens (Human) CVCL_1045
VCaP cells Prostate Homo sapiens (Human) CVCL_2235
WPE1-NA22 cells Prostate Homo sapiens (Human) CVCL_3810
WPE1-NB11 cells Prostate Homo sapiens (Human) CVCL_3811
WPE1-NB14 cells Prostate Homo sapiens (Human) CVCL_3812
WPE1-NB26 cells Prostate Homo sapiens (Human) CVCL_3813
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Docetaxel-resistant cells showed a reduced E-cadherin and an increased vimentin expression accompanied by induced expression of stem cell markers compared with parental cells. Decreased Expression of miR-200c and miR-205 Is Responsible for E-Cadherin Loss in Chemotherapy-Resistant Cells. And miR-205 and miR-31 regulate apoptosis in prostate cancer cells by targeting antiapoptotic proteins Bcl-w and E2F6.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [6], [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Colony formation assay; MTT assay; Drug resistance clonogenic assay
Mechanism Description The reintroduction of miR-205 is shown to inhibit cell proliferation and clonogenic potential, and increase the sensitivity of MCF-7 and MDA-MB-231 cells to docetaxel. miR-205 also shows a synergistic effect with docetaxel in vivo. And miR-205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PI3K/AKT signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Drug resistance clonogenic assay
Mechanism Description miR-205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Epirubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Breast cancer patients Homo sapiens
Experiment for
Molecule Alteration
TaqMan Real-time PCR microRNA Array
Mechanism Description After being analyzed, 8 miRNAs satisfied the criteria. Of those 8 miRNAs, 6 were up-regulated and 2 were down-regulated in the resistant group compared with the sensitive group.
Erlotinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [9]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Resistant Drug Erlotinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Biosynthesis of steroids Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
High-throughput miRNA analysis
Experiment for
Drug Resistance
Sulforhodamine-B assay
Mechanism Description Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [10]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell growth Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
Experiment for
Molecule Alteration
RT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
Fluorescence-activated cell sorting assay
Mechanism Description The activation of the PI3k/Akt survival pathway, so critically important in tumorigenesis, is for the most part driven through phosphorylation of the kinase-inactive member HER3. miR-205, negatively regulating HER3, is able to inhibit breast cancer cell proliferation and improves the response to specific targeted therapies. The reintroduction of miR-205 in SkBr3 cells inhibits their clonogenic potential and increases the responsiveness to tyrosine-kinase inhibitors Gefitinib and Lapatinib, abrogating the HER3-mediated resistance and restoring a potent proapoptotic activity.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [11]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [12]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MIA PaCa-2R cells Pancreas Homo sapiens (Human) CVCL_HA89
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometric analysis
Mechanism Description miR205 resensitizes GEM-resistant pancreatic cancer cells to GEM and acts as a tumor suppressor miRNA.
Disease Class: Cholangiocarcinoma [ICD-11: 2C12.0] [13]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HuCCT1 cells Bile duct Homo sapiens (Human) CVCL_0324
HuH28 cells Bile duct Homo sapiens (Human) CVCL_2955
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-205 could conferred Gem sensitivity to innately Gem-resistant CCA cells.
Lapatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [10]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Lapatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell growth Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
Experiment for
Molecule Alteration
RT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
Fluorescence-activated cell sorting assay
Mechanism Description The activation of the PI3k/Akt survival pathway, so critically important in tumorigenesis, is for the most part driven through phosphorylation of the kinase-inactive member HER3. miR-205, negatively regulating HER3, is able to inhibit breast cancer cell proliferation and improves the response to specific targeted therapies. The reintroduction of miR-205 in SkBr3 cells inhibits their clonogenic potential and increases the responsiveness to tyrosine-kinase inhibitors Gefitinib and Lapatinib, abrogating the HER3-mediated resistance and restoring a potent proapoptotic activity.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Breast cancer patients Homo sapiens
Experiment for
Molecule Alteration
TaqMan Real-time PCR microRNA Array
Mechanism Description After being analyzed, 8 miRNAs satisfied the criteria. Of those 8 miRNAs, 6 were up-regulated and 2 were down-regulated in the resistant group compared with the sensitive group.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [14]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description In MDA-MB-231 cells, down-regulated LncRNA-ROR could inhibit the EMT of breast cancer cells and enhance the sensibility of breast cancer cells to tamoxifen by increasing miR205 expression and suppressing the expressions of ZEB1 and ZEB2.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [14]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description In MDA-MB-231 cells, down-regulated LncRNA-ROR could inhibit the EMT of breast cancer cells and enhance the sensibility of breast cancer cells to tamoxifen by increasing miR205 expression and suppressing the expressions of ZEB1 and ZEB2.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [15]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 2 miR-205 promotes the growth, metastasis and chemoresistance of NSCLC cells by targeting PTEN. Oncol Rep. 2013 Dec;30(6):2897-902. doi: 10.3892/or.2013.2755. Epub 2013 Sep 30.
Ref 3 Downregulation of miR-205 and miR-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells. Cell Death Dis. 2010 Dec 9;1(12):e105. doi: 10.1038/cddis.2010.85.
Ref 4 Ultrasound targeted microbubble destruction mediated miR 205 enhances cisplatin cytotoxicity in prostate cancer cells. Mol Med Rep. 2018 Sep;18(3):3242-3250. doi: 10.3892/mmr.2018.9316. Epub 2018 Jul 24.
Ref 5 miR-205 impairs the autophagic flux and enhances cisplatin cytotoxicity in castration-resistant prostate cancer cells. Biochem Pharmacol. 2014 Feb 15;87(4):579-97. doi: 10.1016/j.bcp.2013.12.009. Epub 2013 Dec 24.
Ref 6 miRNA-205 targets VEGFA and FGF2 and regulates resistance to chemotherapeutics in breast cancer. Cell Death Dis. 2016 Jun 30;7(6):e2291. doi: 10.1038/cddis.2016.194.
Ref 7 Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. Am J Pathol. 2012 Dec;181(6):2188-201. doi: 10.1016/j.ajpath.2012.08.011. Epub 2012 Oct 3.
Ref 8 MicroRNA-205 increases the sensitivity of docetaxel in breast cancer. Oncol Lett. 2016 Feb;11(2):1105-1109. doi: 10.3892/ol.2015.4030. Epub 2015 Dec 11.
Ref 9 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 10 microRNA-205 regulates HER3 in human breast cancer. Cancer Res. 2009 Mar 15;69(6):2195-200. doi: 10.1158/0008-5472.CAN-08-2920. Epub 2009 Mar 10.
Ref 11 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 12 Chemosensitization and inhibition of pancreatic cancer stem cell proliferation by overexpression of microRNA-205. Cancer Lett. 2017 Aug 28;402:1-8. doi: 10.1016/j.canlet.2017.05.007. Epub 2017 May 20.
Ref 13 miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. doi: 10.1371/journal.pone.0077623. eCollection 2013.
Ref 14 Effects of long noncoding RNA-ROR on tamoxifen resistance of breast cancer cells by regulating microRNA-205. Cancer Chemother Pharmacol. 2017 Feb;79(2):327-337. doi: 10.1007/s00280-016-3208-2. Epub 2017 Jan 6.
Ref 15 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.