Molecule Information
General Information of the Molecule (ID: Mol01368)
Name |
hsa-mir-192
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 192
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR192
|
||||
Gene ID | |||||
Location |
chr11:64891137-64891246[-]
|
||||
Sequence |
GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUCGUCUCCC
CUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-192 induced Cisplatin-resistance and inhibited cell apoptosis in lung cancer via negative targeting Bim expression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung adenocarcinoma | [2] | |||
Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Clonogenic assay | |||
Mechanism Description | Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01). |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.