Molecule Information

General Information of the Molecule (ID: Mol01368)

Name	hsa-mir-192 ,Homo sapiens
Synonyms	microRNA 192 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR192
Gene ID	406967
Location	chr11:64891137-64891246[-]
Sequence	GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUCGUCUCCC CUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGC Click to Show/Hide
Ensembl ID	ENSG00000283926
HGNC ID	HGNC:31562
Precursor Accession	MI0000234
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5]				[1]
Resistant Disease	Lung cancer [ICD-11: 2C25.5]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR-192 induced Cisplatin-resistance and inhibited cell apoptosis in lung cancer via negative targeting Bim expression.

Docetaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0]				[2]
Resistant Disease	Lung adenocarcinoma [ICD-11: 2C25.0]			Disease Info
Resistant Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	SPC-A1 cells	Lung	Homo sapiens (Human)	CVCL_6955
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Clonogenic assay
Mechanism Description	Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

References

Ref 1	[MiR-192 confers cisplatin resistance by targeting Bim in lung cancer]. Zhongguo Fei Ai Za Zhi. 2014 May;17(5):384-90. doi: 10.3779/j.issn.1009-3419.2014.05.04.
Ref 2	Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.