Molecule Information

General Information of the Molecule (ID: Mol01367)

• Name: hsa-mir-106a ,Homo sapiens
• Synonyms: microRNA 106a
• Molecule Type: Precursor miRNA
• Gene Name: MIR106A
• Gene ID: 406899
• Location: chrX:134170198-134170278[-]
• Sequence:
  CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAA
  GCACUUCUUACAUUACCAUGG
• Ensembl ID: ENSG00000284157
• HGNC ID: HGNC:31494
• Precursor Accession: MI0000113

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR 106a expression levels were upregulated in the DDP-resistant cell line A549/DDP compared with its parental cell line, A549. miR 106a-transfection induced DDP resistance in A549 cells, while repression of miR 106a by anti miR 106a in A549/DDP resulted in (+) DDP cytotoxicity. Furthermore, it was discovered that the mechanism of miR 106a induced DDP resistance involved the expression of adenosine triphosphatase binding cassette, sub family A, member 1 (ABCA1), as indicated by transfection of cells with short interfering RNA-ABCA1.

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The enhancement of miR-106a expression contributes to the generation of CDDP-resistant ovarian cancer cells, partly by targeting PDCD4. PDCD4 promoted CDDP-induced apoptosis mainly through the death receptor-mediated pathway.

Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Activation; hsa05235
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-106a is up-regulated in the DDP-resistant SGC7901/DDP cells, Overexpression of miR-106a in the SGC7901 cells confers resistance to DDP, PTEN is a target gene of miR-106a, there was a consistent and strong inverse correlation between the miR-106a levels and PTEN, PTEN is a key signal molecule in miR-106a-regulated DDP resistance in SGC7901/DDP cells.

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780/DDP cells; Ovary; Homo sapiens (Human); CVCL_D619
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Knockdown of miR-106a dramatically decreased antiproliferative effects and apoptosis in-duced by cisplatin in A2780 cells, while overexpression of miR-106a significantly increased antiprolif-erative effects and apoptosis induced by cisplatin in A2780/DDP cells. Furthermore, miR-106a inhibited cell survival and cisplatin resistance through downregulating the expression of Mcl-1. Mcl-1 was a di-rect target of miR-106a.

Dasatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [5]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Dasatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR106a/ULk1 signaling pathway; Inhibition; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Resazurin conversion assay
• Mechanism Description: Src inhibition results in autophagy activation in NSCLC cell lines. Combining Src with autophagy inhibition results in significant cell death. Induction of ULk1 upon Scr inhibition allows for autophagy activation. Src inhibition causes induction of the ULk1 targeting microRNA-106a. Expression of the "oncogenic" miR-106a sensitizes NSCLC cells to Src inhibition.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: TGF-beta signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-106a, elevated in multidrug-resistant GC cell lines, suppressed the sensitivity of GC cells to chemo-therapeutic drugs by accelerating drug efflux and reducing apoptosis. Moreover, we validated RUNX3 as a target of miR-106a in GC cells, indicating that miR-106a might modulate MDR by regulating RUNX3 in GC.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [8]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-106a Reduces 5-Fluorouracil (5-FU) Sensitivity of Colorectal Cancer by downregulating Dual-Specificity Phosphatases 2 (DUSP2).

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [9]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Lung cancer patients blood samples; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: High expression of miR-106a may be involved in the development of NSCLC. MiR-106a has significance in the prognosis of NSCLC. The level of miR-106a in the serum can be a useful parameter in screening for drug resistance during cisplatin-based chemotherapy.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [10]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assay
• Mechanism Description: miR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [11]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: TGF-beta signaling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-106a, elevated in multidrug-resistant GC cell lines, suppressed the sensitivity of GC cells to chemo-therapeutic drugs by accelerating drug efflux and reducing apoptosis. Moreover, we validated RUNX3 as a target of miR-106a in GC cells, indicating that miR-106a might modulate MDR by regulating RUNX3 in GC.

Clinical Trial Drug(s) 1 drug(s) in total

Saracatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [5]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Saracatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR106a/ULk1 signaling pathway; Inhibition; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Resazurin conversion assay
• Mechanism Description: Src inhibition results in autophagy activation in NSCLC cell lines. Combining Src with autophagy inhibition results in significant cell death. Induction of ULk1 upon Scr inhibition allows for autophagy activation. Src inhibition causes induction of the ULk1 targeting microRNA-106a. Expression of the "oncogenic" miR-106a sensitizes NSCLC cells to Src inhibition.

References

• Ref 1: MicroRNA-106a confers cisplatin resistance in non-small cell lung cancer A549 cells by targeting adenosine triphosphatase-binding cassette A1. Mol Med Rep. 2015 Jan;11(1):625-32. doi: 10.3892/mmr.2014.2688. Epub 2014 Oct 17.
• Ref 2: microRNA-106a modulates cisplatin sensitivity by targeting PDCD4 in human ovarian cancer cells. Oncol Lett. 2014 Jan;7(1):183-188. doi: 10.3892/ol.2013.1644. Epub 2013 Oct 29.
• Ref 3: miR-106a confers cisplatin resistance by regulating PTEN/Akt pathway in gastric cancer cells. Acta Biochim Biophys Sin (Shanghai). 2013 Nov;45(11):963-72. doi: 10.1093/abbs/gmt106. Epub 2013 Oct 9.
• Ref 4: MiR-106a targets Mcl-1 to suppress cisplatin resistance of ovarian cancer A2780 cells. J Huazhong Univ Sci Technolog Med Sci. 2013 Aug;33(4):567-572. doi: 10.1007/s11596-013-1160-5. Epub 2013 Aug 1.
• Ref 5: MicroRNA-106a targets autophagy and enhances sensitivity of lung cancer cells to Src inhibitors. Lung Cancer. 2017 May;107:73-83. doi: 10.1016/j.lungcan.2016.06.004. Epub 2016 Jun 14.
• Ref 6: MicroRNA-106a induces multidrug resistance in gastric cancer by targeting RUNX3. FEBS Lett. 2013 Sep 17;587(18):3069-75. doi: 10.1016/j.febslet.2013.06.058. Epub 2013 Aug 8.
• Ref 7: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 8: miR-106a Reduces 5-Fluorouracil (5-FU) Sensitivity of Colorectal Cancer by Targeting Dual-Specificity Phosphatases 2 (DUSP2). Med Sci Monit. 2018 Jul 16;24:4944-4951. doi: 10.12659/MSM.910016.
• Ref 9: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 10: Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61. doi: 10.1038/bjc.2013.305. Epub 2013 Jun 27.
• Ref 11: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.