Molecule Information
General Information of the Molecule (ID: Mol01367)
Name |
hsa-mir-106a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 106a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR106A
|
||||
Gene ID | |||||
Location |
chrX:134170198-134170278[-]
|
||||
Sequence |
CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAA
GCACUUCUUACAUUACCAUGG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR 106a expression levels were upregulated in the DDP-resistant cell line A549/DDP compared with its parental cell line, A549. miR 106a-transfection induced DDP resistance in A549 cells, while repression of miR 106a by anti miR 106a in A549/DDP resulted in (+) DDP cytotoxicity. Furthermore, it was discovered that the mechanism of miR 106a induced DDP resistance involved the expression of adenosine triphosphatase binding cassette, sub family A, member 1 (ABCA1), as indicated by transfection of cells with short interfering RNA-ABCA1. | |||
Disease Class: Ovarian cancer | [2] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | The enhancement of miR-106a expression contributes to the generation of CDDP-resistant ovarian cancer cells, partly by targeting PDCD4. PDCD4 promoted CDDP-induced apoptosis mainly through the death receptor-mediated pathway. | |||
Disease Class: Gastric cancer | [3] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
PTEN/AKT signaling pathway | Activation | hsa05235 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-106a is up-regulated in the DDP-resistant SGC7901/DDP cells, Overexpression of miR-106a in the SGC7901 cells confers resistance to DDP, PTEN is a target gene of miR-106a, there was a consistent and strong inverse correlation between the miR-106a levels and PTEN, PTEN is a key signal molecule in miR-106a-regulated DDP resistance in SGC7901/DDP cells. | |||
Disease Class: Ovarian cancer | [4] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
A2780/DDP cells | Ovary | Homo sapiens (Human) | CVCL_D619 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Knockdown of miR-106a dramatically decreased antiproliferative effects and apoptosis in-duced by cisplatin in A2780 cells, while overexpression of miR-106a significantly increased antiprolif-erative effects and apoptosis induced by cisplatin in A2780/DDP cells. Furthermore, miR-106a inhibited cell survival and cisplatin resistance through downregulating the expression of Mcl-1. Mcl-1 was a di-rect target of miR-106a. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [5] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Dasatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
miR106a/ULk1 signaling pathway | Inhibition | hsa05206 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
Resazurin conversion assay | |||
Mechanism Description | Src inhibition results in autophagy activation in NSCLC cell lines. Combining Src with autophagy inhibition results in significant cell death. Induction of ULk1 upon Scr inhibition allows for autophagy activation. Src inhibition causes induction of the ULk1 targeting microRNA-106a. Expression of the "oncogenic" miR-106a sensitizes NSCLC cells to Src inhibition. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [6] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
TGF-beta signaling pathway | Regulation | hsa04350 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-106a, elevated in multidrug-resistant GC cell lines, suppressed the sensitivity of GC cells to chemo-therapeutic drugs by accelerating drug efflux and reducing apoptosis. Moreover, we validated RUNX3 as a target of miR-106a in GC cells, indicating that miR-106a might modulate MDR by regulating RUNX3 in GC. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [7] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-106a Reduces 5-Fluorouracil (5-FU) Sensitivity of Colorectal Cancer by downregulating Dual-Specificity Phosphatases 2 (DUSP2). |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [8] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
TUNEL assay | |||
Mechanism Description | miR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [6] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell proliferation | Activation | hsa05200 | ||
TGF-beta signaling pathway | Regulation | hsa04350 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-106a, elevated in multidrug-resistant GC cell lines, suppressed the sensitivity of GC cells to chemo-therapeutic drugs by accelerating drug efflux and reducing apoptosis. Moreover, we validated RUNX3 as a target of miR-106a in GC cells, indicating that miR-106a might modulate MDR by regulating RUNX3 in GC. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [5] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Saracatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
miR106a/ULk1 signaling pathway | Inhibition | hsa05206 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
Resazurin conversion assay | |||
Mechanism Description | Src inhibition results in autophagy activation in NSCLC cell lines. Combining Src with autophagy inhibition results in significant cell death. Induction of ULk1 upon Scr inhibition allows for autophagy activation. Src inhibition causes induction of the ULk1 targeting microRNA-106a. Expression of the "oncogenic" miR-106a sensitizes NSCLC cells to Src inhibition. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.