General Information of the Molecule (ID: Mol01367)
Name
hsa-mir-106a ,Homo sapiens
Synonyms
microRNA 106a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR106A
Gene ID
406899
Location
chrX:134170198-134170278[-]
Sequence
CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAA
GCACUUCUUACAUUACCAUGG
    Click to Show/Hide
Ensembl ID
ENSG00000284157
HGNC ID
HGNC:31494
Precursor Accession
MI0000113
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR 106a expression levels were upregulated in the DDP-resistant cell line A549/DDP compared with its parental cell line, A549. miR 106a-transfection induced DDP resistance in A549 cells, while repression of miR 106a by anti miR 106a in A549/DDP resulted in (+) DDP cytotoxicity. Furthermore, it was discovered that the mechanism of miR 106a induced DDP resistance involved the expression of adenosine triphosphatase binding cassette, sub family A, member 1 (ABCA1), as indicated by transfection of cells with short interfering RNA-ABCA1.
Disease Class: Ovarian cancer [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description The enhancement of miR-106a expression contributes to the generation of CDDP-resistant ovarian cancer cells, partly by targeting PDCD4. PDCD4 promoted CDDP-induced apoptosis mainly through the death receptor-mediated pathway.
Disease Class: Gastric cancer [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
PTEN/AKT signaling pathway Activation hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-106a is up-regulated in the DDP-resistant SGC7901/DDP cells, Overexpression of miR-106a in the SGC7901 cells confers resistance to DDP, PTEN is a target gene of miR-106a, there was a consistent and strong inverse correlation between the miR-106a levels and PTEN, PTEN is a key signal molecule in miR-106a-regulated DDP resistance in SGC7901/DDP cells.
Disease Class: Ovarian cancer [4]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780/DDP cells Ovary Homo sapiens (Human) CVCL_D619
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Knockdown of miR-106a dramatically decreased antiproliferative effects and apoptosis in-duced by cisplatin in A2780 cells, while overexpression of miR-106a significantly increased antiprolif-erative effects and apoptosis induced by cisplatin in A2780/DDP cells. Furthermore, miR-106a inhibited cell survival and cisplatin resistance through downregulating the expression of Mcl-1. Mcl-1 was a di-rect target of miR-106a.
Dasatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [5]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Dasatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
miR106a/ULk1 signaling pathway Inhibition hsa05206
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Resazurin conversion assay
Mechanism Description Src inhibition results in autophagy activation in NSCLC cell lines. Combining Src with autophagy inhibition results in significant cell death. Induction of ULk1 upon Scr inhibition allows for autophagy activation. Src inhibition causes induction of the ULk1 targeting microRNA-106a. Expression of the "oncogenic" miR-106a sensitizes NSCLC cells to Src inhibition.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [6]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
TGF-beta signaling pathway Regulation hsa04350
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-106a, elevated in multidrug-resistant GC cell lines, suppressed the sensitivity of GC cells to chemo-therapeutic drugs by accelerating drug efflux and reducing apoptosis. Moreover, we validated RUNX3 as a target of miR-106a in GC cells, indicating that miR-106a might modulate MDR by regulating RUNX3 in GC.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [7]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-106a Reduces 5-Fluorouracil (5-FU) Sensitivity of Colorectal Cancer by downregulating Dual-Specificity Phosphatases 2 (DUSP2).
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [8]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
TUNEL assay
Mechanism Description miR-106a and miR-591 have important roles in conferring PTX resistance to ovarian cancer cells. Modulation of these microRNAs resensitizes PTX-resistant cancer cells by targeting BCL10, caspase-7, and ZEB1.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [6]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell proliferation Activation hsa05200
TGF-beta signaling pathway Regulation hsa04350
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-106a, elevated in multidrug-resistant GC cell lines, suppressed the sensitivity of GC cells to chemo-therapeutic drugs by accelerating drug efflux and reducing apoptosis. Moreover, we validated RUNX3 as a target of miR-106a in GC cells, indicating that miR-106a might modulate MDR by regulating RUNX3 in GC.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Saracatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [5]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Saracatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
miR106a/ULk1 signaling pathway Inhibition hsa05206
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Resazurin conversion assay
Mechanism Description Src inhibition results in autophagy activation in NSCLC cell lines. Combining Src with autophagy inhibition results in significant cell death. Induction of ULk1 upon Scr inhibition allows for autophagy activation. Src inhibition causes induction of the ULk1 targeting microRNA-106a. Expression of the "oncogenic" miR-106a sensitizes NSCLC cells to Src inhibition.
References
Ref 1 MicroRNA-106a confers cisplatin resistance in non-small cell lung cancer A549 cells by targeting adenosine triphosphatase-binding cassette A1. Mol Med Rep. 2015 Jan;11(1):625-32. doi: 10.3892/mmr.2014.2688. Epub 2014 Oct 17.
Ref 2 microRNA-106a modulates cisplatin sensitivity by targeting PDCD4 in human ovarian cancer cells. Oncol Lett. 2014 Jan;7(1):183-188. doi: 10.3892/ol.2013.1644. Epub 2013 Oct 29.
Ref 3 miR-106a confers cisplatin resistance by regulating PTEN/Akt pathway in gastric cancer cells. Acta Biochim Biophys Sin (Shanghai). 2013 Nov;45(11):963-72. doi: 10.1093/abbs/gmt106. Epub 2013 Oct 9.
Ref 4 MiR-106a targets Mcl-1 to suppress cisplatin resistance of ovarian cancer A2780 cells. J Huazhong Univ Sci Technolog Med Sci. 2013 Aug;33(4):567-572. doi: 10.1007/s11596-013-1160-5. Epub 2013 Aug 1.
Ref 5 MicroRNA-106a targets autophagy and enhances sensitivity of lung cancer cells to Src inhibitors. Lung Cancer. 2017 May;107:73-83. doi: 10.1016/j.lungcan.2016.06.004. Epub 2016 Jun 14.
Ref 6 MicroRNA-106a induces multidrug resistance in gastric cancer by targeting RUNX3. FEBS Lett. 2013 Sep 17;587(18):3069-75. doi: 10.1016/j.febslet.2013.06.058. Epub 2013 Aug 8.
Ref 7 miR-106a Reduces 5-Fluorouracil (5-FU) Sensitivity of Colorectal Cancer by Targeting Dual-Specificity Phosphatases 2 (DUSP2). Med Sci Monit. 2018 Jul 16;24:4944-4951. doi: 10.12659/MSM.910016.
Ref 8 Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61. doi: 10.1038/bjc.2013.305. Epub 2013 Jun 27.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.