Molecule Information
General Information of the Molecule (ID: Mol01362)
| Name |
hsa-mir-101
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 101-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR101-1
|
||||
| Gene ID | |||||
| Location |
chr1:65058434-65058508[-]
|
||||
| Sequence |
UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUUCUAAAGGUACAGUACUGUGAU
AACUGAAGGAUGGCA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [1] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [1] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib. | |||
| Disease Class: Colon carcinoma [ICD-11: 2B90.2] | [1] | |||
| Sensitive Disease | Colon carcinoma [ICD-11: 2B90.2] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib. | |||
| Disease Class: Hepatocellular cancer [ICD-11: 2C12.4] | [1] | |||
| Sensitive Disease | Hepatocellular cancer [ICD-11: 2C12.4] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-101 functions as an endogenous proteasome inhibitor by targeting POMP. Targeting POMP is essential for cell growth suppression by miR-101. High miR-101 levels have good outcomes for ERalpha-positive breast cancer patients. Targeting POMP inhibits tumor progression and overcomes resistance to bortezomib. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| p38/MAPK/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| SGC7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | miR101 alleviates chemoresistance of gastric cancer cells by targeting ANXA2, ectopic expression of ANXA2 reversed the effect of miR101 on P-gp expression, cell viability and apoptosis. knockdown of ANXA2 increased sensitivity to doxorubicin, 5-FU and DDP by regulating p38MAPk and AkT pathways. | |||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [3] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay; AO/EB double staining; Transwell invasion assay | |||
| Mechanism Description | Upregulation of miR101 enhances the cytotoxic effect of anticancer drugs through inhibition of colon cancer cell proliferation. The upregulated expression of miR101 inhibited proliferation and migration, and increased the sensitivity of colon cancer cells to chemotherapy. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SGC7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry analysis assay | |||
| Mechanism Description | miR-101 inhibits proliferation and promotes DDP-induced apoptosis of SGC7901/DDP cells via negatively mediating the expression of VEGF-C, which facilitate gastric cancer cells sensitivity to Cisplatin. | |||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [5] | |||
| Sensitive Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; BrdU assay | |||
| Mechanism Description | miR-101 overexpression decreased the expression of EZH2, reduced proliferation and migration of ovarian cancer cells, and resensitized drug-resistant cancer cells to cisplatin-induced cytotoxicity. | |||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [6] | |||
| Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Enforced expression of miR-101 enhances cisplatin sensitivity in human bladder cancer cells by downregulating the cyclooxygenase-2 pathway. | |||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [7] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| NCl-H596 cells | Lung | Homo sapiens (Human) | CVCL_1571 | |
| NCI-H520 cells | Lung | Homo sapiens (Human) | CVCL_1566 | |
| NCI-460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Transwell migration assay; MTS assay | |||
| Mechanism Description | Low miR-101 expression promotes EMT in cisplatin-resistant NSCLC cells. ROCk2 was the direct target of miR-101 and that ROCk2 overexpression reversed miR-101-mediatedEMT and cisplatin resistance in NSCLC cells. ROCk2 protein levels were inversely correlated with miR-101 levels in NSCLC tissue samples and that low miR-101 expression was correlated with poor survival time. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [8] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-101 was downregulated in HCC cell lines, while its overexpression (+) the sensitivity of HepG2 cells to the chemotherapeutic agent DOX by facilitating apoptosis. Of note, Mcl-1 was confirmed as a functional target of miR-101 in HCC, demonstrating that miR-101 may enhance the sensitivity of cancer cells by downregulating Mcl-1 expression. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [9] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
Quantitative GFP-LC3 analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The miR-101 not only decreases the formation of autophagic vesicles but also reduces the expression of LC-3II and Atg 4. This part of the study shows that miR-101 blocks chemotherapy-induced autophagy in OS cells. The sensitivity of OS cells to chemotherapy is increased by miR-101 blocked autophagy. miR-101 blocked the chemotherapy induced autophagy, and the blocked autophagy by miR-101 enhances the sensitivity of the OS cell line U-2 in vitro. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [10] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | miR-101-mediated EZH2 silencing sensitized hepatoblastoma cells to 5-FU- and doxorubicin-induced apoptosis, whereas antagomiR-mediated downregulation of endogenous miR-101 reversed the pro-apoptotic effect. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [3] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay; AO/EB double staining; Transwell invasion assay | |||
| Mechanism Description | Upregulation of miR101 enhances the cytotoxic effect of anticancer drugs through inhibition of colon cancer cell proliferation. The upregulated expression of miR101 inhibited proliferation and migration, and increased the sensitivity of colon cancer cells to chemotherapy. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [10] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| SNU182 cells | Liver | Homo sapiens (Human) | CVCL_0090 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | miR-101-mediated EZH2 silencing sensitized hepatoblastoma cells to 5-FU- and doxorubicin-induced apoptosis, whereas antagomiR-mediated downregulation of endogenous miR-101 reversed the pro-apoptotic effect. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [11] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V apoptosis assay; Caspase-3 activity assay | |||
| Mechanism Description | microRNA-101 silences RNA-Pkcs and sensitizes pancreatic cancer cells to gemcitabine. AntagomiR101 expression causes RNA-Pkcs upregulation and gemcitabine resistance. miR101 expression inhibits Akt activation in PANC-1 cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [12] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expressiom | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell colony | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; TUNEL assay; Flow cytometry assay | |||
| Mechanism Description | The endogenous protein level of GSk3beta and MGMT was significantly suppressed by combination of MALAT1 knockdown and miR-101 overexpression and the promoter methylation of MGMT was largely promoted by the combination of MALAT1 knockdown and miR-101 overexpression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [13] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 |
| T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
| U251-MG cells | Brain | Homo sapiens (Human) | CVCL_0021 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
| Mechanism Description | microRNA-101 reverses temozolomide resistance by inhibition of GSk3beta in glioblastoma. | |||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [12] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell colony | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; TUNEL assay; Flow cytometry assay | |||
| Mechanism Description | The endogenous protein level of GSk3beta and MGMT was significantly suppressed by combination of MALAT1 knockdown and miR-101 overexpression and the promoter methylation of MGMT was largely promoted by the combination of MALAT1 knockdown and miR-101 overexpression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| p38/MAPK/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| SGC7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | miR101 alleviates chemoresistance of gastric cancer cells by targeting ANXA2, ectopic expression of ANXA2 reversed the effect of miR101 on P-gp expression, cell viability and apoptosis. knockdown of ANXA2 increased sensitivity to doxorubicin, 5-FU and DDP by regulating p38MAPk and AkT pathways. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
