Molecule Information
General Information of the Molecule (ID: Mol01361)
| Name |
hsa-mir-100
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 100
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR100
|
||||
| Gene ID | |||||
| Location |
chr11:122152229-122152308[-]
|
||||
| Sequence |
CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCU
AUAGGUAUGUGUCUGUUAGG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
15 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | [1] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxic Assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | |
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| DLD1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| CaCo2 cells | Colon | Homo sapiens (Human) | CVCL_0025 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
| NCI-H508 cells | Colon | Homo sapiens (Human) | CVCL_1564 | |
| SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
| COLO 320DM cells | Colon | Homo sapiens (Human) | CVCL_0219 | |
| HCT15 cells | Colon | Homo sapiens (Human) | CVCL_0292 | |
| LS174T cells | Colon | Homo sapiens (Human) | CVCL_1384 | |
| NCI-H716 cells | Colon | Homo sapiens (Human) | CVCL_1581 | |
| SW948 cells | Colon | Homo sapiens (Human) | CVCL_0632 | |
| SW403 cells | Colon | Homo sapiens (Human) | CVCL_0545 | |
| SW48 cells | Colon | Homo sapiens (Human) | CVCL_1724 | |
| COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
| HuTu80 cells | Small intestine | Homo sapiens (Human) | CVCL_1301 | |
| LS123 cells | Colon | Homo sapiens (Human) | CVCL_1383 | |
| SK-CO-1 cells | Colon | Homo sapiens (Human) | CVCL_0626 | |
| SW837 cells | Colon | Homo sapiens (Human) | CVCL_1729 | |
| T84 cells | Colon | Homo sapiens (Human) | CVCL_0555 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
Luciferase reporter assay; qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR100 and miR125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness. | |||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | |
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| GIST-T1 cells | Gastric | Homo sapiens (Human) | CVCL_4976 | |
| CAL62 cells | Thyroid gland | Homo sapiens (Human) | CVCL_1112 | |
| CAL-62 cells | Thyroid gland | Homo sapiens (Human) | CVCL_1112 | |
| CCL-131 cells | Brain | Mus musculus (Mouse) | CVCL_0470 | |
| COLO320DM cells | Colon | Homo sapiens (Human) | CVCL_0219 | |
| CT26 WT cells | Colon | Mus musculus (Mouse) | CVCL_7256 | |
| Detroit562 cells | Pleural effusion | Homo sapiens (Human) | CVCL_1171 | |
| DIPG 007 cells | Brain | Homo sapiens (Human) | CVCL_VU70 | |
| DLD-1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| DU145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 | |
| FL83B cells | Liver | Mus musculus (Mouse) | CVCL_4691 | |
| GH3 cells | Pituitary gland | Rattus norvegicus (Rat) | CVCL_0273 | |
| GH4C1 cells | pituitary gland | Rattus norvegicus (Rat) | CVCL_0276 | |
| H1650 cells | Pleural effusion | Homo sapiens (Human) | CVCL_4V01 | |
| H9 cells | Peripheral blood | Homo sapiens (Human) | CVCL_1240 | |
| H9/HTLV cells | Peripheral blood | Homo sapiens (Human) | CVCL_3514 | |
| HEK 293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| HeLa S cells | Uterus | Homo sapiens (Human) | CVCL_0058 | |
| HeLa229 cells | Uterus | Homo sapiens (Human) | CVCL_1276 | |
| HH cells | Peripheral blood | Homo sapiens (Human) | CVCL_1280 | |
| HPrEC cells | Prostate | Homo sapiens (Human) | CVCL_A2EM | |
| Human RPMI8226 myeloma cells | Peripheral blood | Homo sapiens (Human) | CVCL_0014 | |
| KB-C2 cells | Uterus | Homo sapiens (Human) | CVCL_D600 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Mechanism Description | miR-100HG, miR-100 and miR-125b overexpression was also observed in cetuximab-resistant colorectal cancer and head and neck squamous cell cancer cell lines and in tumors from colorectal cancer patients that progressed on cetuximab. miR-100 and miR-125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [3] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| SkOV3/DDP cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Crystal violet staining assay | |||
| Mechanism Description | miR100 resensitizes resistant epithelial ovarian cancer to cisplatin probably by inhibiting cell proliferation, inducing apoptosis and arresting cell cycle and by targeted downregulation of mTOR and PLk1 expression. | |||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [4] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 |
| NCI-H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [5] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | The expression of miR-100 is downregulated in SkOV3/DDP cells. Overexpressing miR-100 may effectively increase the sensitivity to cisplatin of human ovarian epithelial cancer SkOV3/DDP cells and may reverse cisplatin-resistance of EOC (epithelial ovarian cancer). | |||
| Disease Class: Chondrosarcoma [ICD-11: 2B50.0] | [6] | |||
| Sensitive Disease | Chondrosarcoma [ICD-11: 2B50.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | mTOR signaling pathway | Inhibition | hsa04150 | |
| In Vitro Model | C-28/l2 cells | Cartilage | Homo sapiens (Human) | CVCL_0187 |
| CHON-001 cells | Cartilage | Homo sapiens (Human) | CVCL_C462 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | mTOR is frequently activated in multiple carcinoma. The overexpression of miR-100 significantly down-regulated mTOR proteins and inhibition of miR-100 restored the expression of mTOR in CH-2879 cells, the present studies highlight miR-100 as a tumor suppressor in chondrosarcoma contributing to anti-chemoresistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] | [7] | |||
| Resistant Disease | Acute lymphocytic leukemia [ICD-11: 2B33.0] | |||
| Resistant Drug | Daunorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
RT-qPCR; RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry; MTT assay | |||
| Mechanism Description | Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001). | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [8] | |||
| Sensitive Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Sensitive Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Plk1 directly promotes mitotic entry by activating Cdc25C and Cdk1 (Cdc2) /Cyclin B complex,introduction of miR-100 significantly decreased Plk1 expression and in turn resensitized SPC-A1/DTX cells to docetaxel. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [4] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 |
| NCI-H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [9] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; CCK8 assay | |||
| Mechanism Description | Either ZNRF2 overexpression or miR100 depletion increased in vitro OS cell growth and improved cell survival at the presence of Doxorubicin. miR100 bindS to the 3'-UTR of ZNRF2 mRNA to prevent its protein translation, re-expression of miR100 may inhibit OS cell growth and decrease OS cell chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [4] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 |
| NCI-H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [10] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | [1] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxic Assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [11] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Homologous recombination-mediated repair pathway | Inhibition | hsa03440 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 | |
| Hs-578T cells | Breast | Homo sapiens (Human) | CVCL_0332 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-100 expression was significantly downregulated in breast cancer, and the downregulation was more extensive in luminal A breast cancers and was associated with worse patient survival. Ectopic expression of miR-100 sensitized, while inhibition of miR-100 expression desensitized, breast cancer cells to the effect of paclitaxel on cell cycle arrest, multinucleation, apoptosis and tumorigenesis. Expression of genes that are part of a known signature of paclitaxel sensitivity in breast cancer significantly correlated with miR-100 expression. Mechanistically, targeting mTOR appeared to mediate miR-100's function in sensitizing breast cancer cells to paclitaxel, but other mechanisms also seem to be involved, including targeting other molecules such as PLk1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] | [12] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.0] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 | |
| Experiment for Molecule Alteration |
RT-PCR; Western blot; Luciferase assay | |||
| Experiment for Drug Resistance |
Cytotoxicity assay; Apoptosis assays | |||
| Mechanism Description | Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [13] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [14] | |||
| Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
| Sensitive Drug | Vemurafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | PLX4032-resistant cells | Skin | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
Western blot analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | CCL2 and miR-125b, miR-34a and miR-100 are potential targets for overcoming the miR-34a and miR-100 are potential targets for overcoming the resistance to BRAFi in melanoma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [15] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] | [16] | |||
| Resistant Disease | Acute lymphocytic leukemia [ICD-11: 2B33.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | ETV6-RUNX1-positive Reh cells | Blood | Homo sapiens (Human) | CVCL_1650 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL). | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
