General Information of the Molecule (ID: Mol01361)
Name
hsa-mir-100 ,Homo sapiens
Synonyms
microRNA 100
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR100
Gene ID
406892
Location
chr11:122152229-122152308[-]
Sequence
CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCU
AUAGGUAUGUGUCUGUUAGG
    Click to Show/Hide
Ensembl ID
ENSG00000207994
HGNC ID
HGNC:31487
Precursor Accession
MI0000102
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
15 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [1]
Resistant Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Cytotoxic Assay
Mechanism Description MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.
Cetuximab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
DLD1 cells Colon Homo sapiens (Human) CVCL_0248
SW620 cells Colon Homo sapiens (Human) CVCL_0547
CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
RkO cells Colon Homo sapiens (Human) CVCL_0504
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
NCI-H508 cells Colon Homo sapiens (Human) CVCL_1564
SW1116 cells Colon Homo sapiens (Human) CVCL_0544
COLO 320DM cells Colon Homo sapiens (Human) CVCL_0219
HCT15 cells Colon Homo sapiens (Human) CVCL_0292
LS174T cells Colon Homo sapiens (Human) CVCL_1384
NCI-H716 cells Colon Homo sapiens (Human) CVCL_1581
SW948 cells Colon Homo sapiens (Human) CVCL_0632
SW403 cells Colon Homo sapiens (Human) CVCL_0545
SW48 cells Colon Homo sapiens (Human) CVCL_1724
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
HuTu80 cells Small intestine Homo sapiens (Human) CVCL_1301
LS123 cells Colon Homo sapiens (Human) CVCL_1383
SK-CO-1 cells Colon Homo sapiens (Human) CVCL_0626
SW837 cells Colon Homo sapiens (Human) CVCL_1729
T84 cells Colon Homo sapiens (Human) CVCL_0555
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
Luciferase reporter assay; qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR100 and miR125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
GIST-T1 cells Gastric Homo sapiens (Human) CVCL_4976
CAL62 cells Thyroid gland Homo sapiens (Human) CVCL_1112
CAL-62 cells Thyroid gland Homo sapiens (Human) CVCL_1112
CCL-131 cells Brain Mus musculus (Mouse) CVCL_0470
COLO320DM cells Colon Homo sapiens (Human) CVCL_0219
CT26 WT cells Colon Mus musculus (Mouse) CVCL_7256
Detroit562 cells Pleural effusion Homo sapiens (Human) CVCL_1171
DIPG 007 cells Brain Homo sapiens (Human) CVCL_VU70
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
DU145 cells Prostate Homo sapiens (Human) CVCL_0105
FL83B cells Liver Mus musculus (Mouse) CVCL_4691
GH3 cells Pituitary gland Rattus norvegicus (Rat) CVCL_0273
GH4C1 cells pituitary gland Rattus norvegicus (Rat) CVCL_0276
H1650 cells Pleural effusion Homo sapiens (Human) CVCL_4V01
H9 cells Peripheral blood Homo sapiens (Human) CVCL_1240
H9/HTLV cells Peripheral blood Homo sapiens (Human) CVCL_3514
HEK 293T cells Kidney Homo sapiens (Human) CVCL_0063
HeLa S cells Uterus Homo sapiens (Human) CVCL_0058
HeLa229 cells Uterus Homo sapiens (Human) CVCL_1276
HH cells Peripheral blood Homo sapiens (Human) CVCL_1280
HPrEC cells Prostate Homo sapiens (Human) CVCL_A2EM
Human RPMI8226 myeloma cells Peripheral blood Homo sapiens (Human) CVCL_0014
KB-C2 cells Uterus Homo sapiens (Human) CVCL_D600
Experiment for
Molecule Alteration
RT-PCR
Mechanism Description miR-100HG, miR-100 and miR-125b overexpression was also observed in cetuximab-resistant colorectal cancer and head and neck squamous cell cancer cell lines and in tumors from colorectal cancer patients that progressed on cetuximab. miR-100 and miR-125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [3]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
SkOV3/DDP cells Ovary Homo sapiens (Human) CVCL_0532
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Crystal violet staining assay
Mechanism Description miR100 resensitizes resistant epithelial ovarian cancer to cisplatin probably by inhibiting cell proliferation, inducing apoptosis and arresting cell cycle and by targeted downregulation of mTOR and PLk1 expression.
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [4]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
NCI-H69AR cells Lung Homo sapiens (Human) CVCL_3513
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [5]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The expression of miR-100 is downregulated in SkOV3/DDP cells. Overexpressing miR-100 may effectively increase the sensitivity to cisplatin of human ovarian epithelial cancer SkOV3/DDP cells and may reverse cisplatin-resistance of EOC (epithelial ovarian cancer).
Disease Class: Chondrosarcoma [ICD-11: 2B50.0] [6]
Sensitive Disease Chondrosarcoma [ICD-11: 2B50.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation mTOR signaling pathway Inhibition hsa04150
In Vitro Model C-28/l2 cells Cartilage Homo sapiens (Human) CVCL_0187
CHON-001 cells Cartilage Homo sapiens (Human) CVCL_C462
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description mTOR is frequently activated in multiple carcinoma. The overexpression of miR-100 significantly down-regulated mTOR proteins and inhibition of miR-100 restored the expression of mTOR in CH-2879 cells, the present studies highlight miR-100 as a tumor suppressor in chondrosarcoma contributing to anti-chemoresistance.
Daunorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [7]
Resistant Disease Acute lymphocytic leukemia [ICD-11: 2B33.0]
Resistant Drug Daunorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
RT-qPCR; RT-PCR
Experiment for
Drug Resistance
Flow cytometry; MTT assay
Mechanism Description Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [8]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Plk1 directly promotes mitotic entry by activating Cdc25C and Cdk1 (Cdc2) /Cyclin B complex,introduction of miR-100 significantly decreased Plk1 expression and in turn resensitized SPC-A1/DTX cells to docetaxel.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [4]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
NCI-H69AR cells Lung Homo sapiens (Human) CVCL_3513
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [9]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell growth Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; CCK8 assay
Mechanism Description Either ZNRF2 overexpression or miR100 depletion increased in vitro OS cell growth and improved cell survival at the presence of Doxorubicin. miR100 bindS to the 3'-UTR of ZNRF2 mRNA to prevent its protein translation, re-expression of miR100 may inhibit OS cell growth and decrease OS cell chemo-resistance.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [4]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Resistant Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
NCI-H69AR cells Lung Homo sapiens (Human) CVCL_3513
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [10]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] [1]
Resistant Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.0]
Resistant Drug Methotrexate
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Cytotoxic Assay
Mechanism Description MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Homologous recombination-mediated repair pathway Inhibition hsa03440
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
BT549 cells Breast Homo sapiens (Human) CVCL_1092
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-100 expression was significantly downregulated in breast cancer, and the downregulation was more extensive in luminal A breast cancers and was associated with worse patient survival. Ectopic expression of miR-100 sensitized, while inhibition of miR-100 expression desensitized, breast cancer cells to the effect of paclitaxel on cell cycle arrest, multinucleation, apoptosis and tumorigenesis. Expression of genes that are part of a known signature of paclitaxel sensitivity in breast cancer significantly correlated with miR-100 expression. Mechanistically, targeting mTOR appeared to mediate miR-100's function in sensitizing breast cancer cells to paclitaxel, but other mechanisms also seem to be involved, including targeting other molecules such as PLk1.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [12]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Resistant Drug Sorafenib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance
Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [13]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration
Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Vemurafenib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [14]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Vemurafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model PLX4032-resistant cells Skin Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
Western blot analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description CCL2 and miR-125b, miR-34a and miR-100 are potential targets for overcoming the miR-34a and miR-100 are potential targets for overcoming the resistance to BRAFi in melanoma.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [15]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [16]
Resistant Disease Acute lymphocytic leukemia [ICD-11: 2B33.0]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model ETV6-RUNX1-positive Reh cells Blood Homo sapiens (Human) CVCL_1650
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL).
References
Ref 1 miR-135a contributes to paclitaxel resistance in tumor cells both in vitro and in vivo. Oncogene. 2011 Oct 27;30(43):4386-98. doi: 10.1038/onc.2011.148. Epub 2011 May 9.
Ref 2 lncRNA MIR100HG-derived miR-100 and miR-125b mediate cetuximab resistance via Wnt/Beta-catenin signaling. Nat Med. 2017 Nov;23(11):1331-1341. doi: 10.1038/nm.4424. Epub 2017 Oct 16.
Ref 3 miR-100 resensitizes resistant epithelial ovarian cancer to cisplatin. Oncol Rep. 2016 Dec;36(6):3552-3558. doi: 10.3892/or.2016.5140. Epub 2016 Oct 3.
Ref 4 Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100. Eur J Cancer. 2014 May;50(8):1541-54. doi: 10.1016/j.ejca.2014.01.024. Epub 2014 Feb 19.
Ref 5 [Expression of microRNA-100 and its correlation with drug resistance in human ovarian cancer SKOV3/DDP cells]. Nan Fang Yi Ke Da Xue Xue Bao. 2015 Nov;35(11):1624-7.
Ref 6 MicroRNA-100 resensitizes resistant chondrosarcoma cells to cisplatin through direct targeting of mTOR. Asian Pac J Cancer Prev. 2014;15(2):917-23. doi: 10.7314/apjcp.2014.15.2.917.
Ref 7 BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
Ref 8 MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1. Cancer Lett. 2012 Apr 28;317(2):184-91. doi: 10.1016/j.canlet.2011.11.024. Epub 2011 Nov 25.
Ref 9 MicroRNA-100 suppresses human osteosarcoma cell proliferation and chemo-resistance via ZNRF2. Oncotarget. 2017 May 23;8(21):34678-34686. doi: 10.18632/oncotarget.16149.
Ref 10 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 11 MicroRNA 100 sensitizes luminal A breast cancer cells to paclitaxel treatment in part by targeting mTOR. Oncotarget. 2016 Feb 2;7(5):5702-14. doi: 10.18632/oncotarget.6790.
Ref 12 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 13 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 14 Overcoming melanoma resistance to vemurafenib by targeting CCL2-induced miR-34a, miR-100 and miR-125b. Oncotarget. 2016 Jan 26;7(4):4428-41. doi: 10.18632/oncotarget.6599.
Ref 15 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 16 MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leuk Res. 2013 Oct;37(10):1315-21. doi: 10.1016/j.leukres.2013.06.027. Epub 2013 Jul 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.