Molecule Information

General Information of the Molecule (ID: Mol01361)

• Name: hsa-mir-100 ,Homo sapiens
• Synonyms: microRNA 100
• Molecule Type: Precursor miRNA
• Gene Name: MIR100
• Gene ID: 406892
• Location: chr11:122152229-122152308[-]
• Sequence:
  CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCU
  AUAGGUAUGUGUCUGUUAGG
• Ensembl ID: ENSG00000207994
• HGNC ID: HGNC:31487
• Precursor Accession: MI0000102

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Cetuximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: NCI-H508 cells; Colon; Homo sapiens (Human); CVCL_1564
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vitro Model: COLO 320DM cells; Colon; Homo sapiens (Human); CVCL_0219
• In Vitro Model: HCT15 cells; Colon; Homo sapiens (Human); CVCL_0292
• In Vitro Model: LS174T cells; Colon; Homo sapiens (Human); CVCL_1384
• In Vitro Model: NCI-H716 cells; Colon; Homo sapiens (Human); CVCL_1581
• In Vitro Model: SW948 cells; Colon; Homo sapiens (Human); CVCL_0632
• In Vitro Model: SW403 cells; Colon; Homo sapiens (Human); CVCL_0545
• In Vitro Model: SW48 cells; Colon; Homo sapiens (Human); CVCL_1724
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vitro Model: HuTu80 cells; Small intestine; Homo sapiens (Human); CVCL_1301
• In Vitro Model: LS123 cells; Colon; Homo sapiens (Human); CVCL_1383
• In Vitro Model: SK-CO-1 cells; Colon; Homo sapiens (Human); CVCL_0626
• In Vitro Model: SW837 cells; Colon; Homo sapiens (Human); CVCL_1729
• In Vitro Model: T84 cells; Colon; Homo sapiens (Human); CVCL_0555
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Luciferase reporter assay; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR100 and miR125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: GIST-T1 cells; Gastric; Homo sapiens (Human); CVCL_4976
• In Vitro Model: CAL62 cells; Thyroid gland; Homo sapiens (Human); CVCL_1112
• In Vitro Model: CAL-62 cells; Thyroid gland; Homo sapiens (Human); CVCL_1112
• In Vitro Model: CCL-131 cells; Brain; Mus musculus (Mouse); CVCL_0470
• In Vitro Model: COLO320DM cells; Colon; Homo sapiens (Human); CVCL_0219
• In Vitro Model: CT26 WT cells; Colon; Mus musculus (Mouse); CVCL_7256
• In Vitro Model: Detroit562 cells; Pleural effusion; Homo sapiens (Human); CVCL_1171
• In Vitro Model: DIPG 007 cells; Brain; Homo sapiens (Human); CVCL_VU70
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: FL83B cells; Liver; Mus musculus (Mouse); CVCL_4691
• In Vitro Model: GH3 cells; Pituitary gland; Rattus norvegicus (Rat); CVCL_0273
• In Vitro Model: GH4C1 cells; pituitary gland; Rattus norvegicus (Rat); CVCL_0276
• In Vitro Model: H1650 cells; Pleural effusion; Homo sapiens (Human); CVCL_4V01
• In Vitro Model: H9 cells; Peripheral blood; Homo sapiens (Human); CVCL_1240
• In Vitro Model: H9/HTLV cells; Peripheral blood; Homo sapiens (Human); CVCL_3514
• In Vitro Model: HEK 293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: HeLa S cells; Uterus; Homo sapiens (Human); CVCL_0058
• In Vitro Model: HeLa229 cells; Uterus; Homo sapiens (Human); CVCL_1276
• In Vitro Model: HH cells; Peripheral blood; Homo sapiens (Human); CVCL_1280
• In Vitro Model: HPrEC cells; Prostate; Homo sapiens (Human); CVCL_A2EM
• In Vitro Model: Human RPMI8226 myeloma cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• In Vitro Model: KB-C2 cells; Uterus; Homo sapiens (Human); CVCL_D600
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: miR-100HG, miR-100 and miR-125b overexpression was also observed in cetuximab-resistant colorectal cancer and head and neck squamous cell cancer cell lines and in tumors from colorectal cancer patients that progressed on cetuximab. miR-100 and miR-125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [2]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: SkOV3/DDP cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Crystal violet staining assay
• Mechanism Description: miR100 resensitizes resistant epithelial ovarian cancer to cisplatin probably by inhibiting cell proliferation, inducing apoptosis and arresting cell cycle and by targeted downregulation of mTOR and PLk1 expression.

Disease Class: Lung small cell carcinoma [3]

• Resistant Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: NCI-H69 cells; Lung; Homo sapiens (Human); CVCL_1579
• In Vitro Model: NCI-H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The expression of miR-100 is downregulated in SkOV3/DDP cells. Overexpressing miR-100 may effectively increase the sensitivity to cisplatin of human ovarian epithelial cancer SkOV3/DDP cells and may reverse cisplatin-resistance of EOC (epithelial ovarian cancer).

Disease Class: Chondrosarcoma [5]

• Sensitive Disease: Chondrosarcoma [ICD-11: 2B50.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: C-28/l2 cells; Cartilage; Homo sapiens (Human); CVCL_0187
• In Vitro Model: CHON-001 cells; Cartilage; Homo sapiens (Human); CVCL_C462
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: mTOR is frequently activated in multiple carcinoma. The overexpression of miR-100 significantly down-regulated mTOR proteins and inhibition of miR-100 restored the expression of mTOR in CH-2879 cells, the present studies highlight miR-100 as a tumor suppressor in chondrosarcoma contributing to anti-chemoresistance.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [6]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Plk1 directly promotes mitotic entry by activating Cdc25C and Cdk1 (Cdc2) /Cyclin B complex,introduction of miR-100 significantly decreased Plk1 expression and in turn resensitized SPC-A1/DTX cells to docetaxel.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [3]

• Resistant Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: NCI-H69 cells; Lung; Homo sapiens (Human); CVCL_1579
• In Vitro Model: NCI-H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [7]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; CCK8 assay
• Mechanism Description: Either ZNRF2 overexpression or miR100 depletion increased in vitro OS cell growth and improved cell survival at the presence of Doxorubicin. miR100 bindS to the 3'-UTR of ZNRF2 mRNA to prevent its protein translation, re-expression of miR100 may inhibit OS cell growth and decrease OS cell chemo-resistance.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [3]

• Resistant Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: NCI-H69 cells; Lung; Homo sapiens (Human); CVCL_1579
• In Vitro Model: NCI-H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Forced expression of HOXA1 in immortalised human mammary epithelial cells results in oncogenic transformation and tumour formation in vivo. HOXA1 expression was inversely correlated with miR-100. HOXA1-mediated SCLC chemoresistance is under the regulation of miR-100. HOXA1 may be a prognostic predictor and potential therapeutic target in human SCLC.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [8]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [9]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Homologous recombination-mediated repair pathway; Inhibition; hsa03440
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-100 expression was significantly downregulated in breast cancer, and the downregulation was more extensive in luminal A breast cancers and was associated with worse patient survival. Ectopic expression of miR-100 sensitized, while inhibition of miR-100 expression desensitized, breast cancer cells to the effect of paclitaxel on cell cycle arrest, multinucleation, apoptosis and tumorigenesis. Expression of genes that are part of a known signature of paclitaxel sensitivity in breast cancer significantly correlated with miR-100 expression. Mechanistically, targeting mTOR appeared to mediate miR-100's function in sensitizing breast cancer cells to paclitaxel, but other mechanisms also seem to be involved, including targeting other molecules such as PLk1.

Vemurafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [10]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Vemurafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PLX4032-resistant cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: Western blot analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: CCL2 and miR-125b, miR-34a and miR-100 are potential targets for overcoming the miR-34a and miR-100 are potential targets for overcoming the resistance to BRAFi in melanoma.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [11]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: ETV6-RUNX1-positive Reh cells; Blood; Homo sapiens (Human); CVCL_1650
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL).

References

• Ref 1: lncRNA MIR100HG-derived miR-100 and miR-125b mediate cetuximab resistance via Wnt/Beta-catenin signaling. Nat Med. 2017 Nov;23(11):1331-1341. doi: 10.1038/nm.4424. Epub 2017 Oct 16.
• Ref 2: miR-100 resensitizes resistant epithelial ovarian cancer to cisplatin. Oncol Rep. 2016 Dec;36(6):3552-3558. doi: 10.3892/or.2016.5140. Epub 2016 Oct 3.
• Ref 3: Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100. Eur J Cancer. 2014 May;50(8):1541-54. doi: 10.1016/j.ejca.2014.01.024. Epub 2014 Feb 19.
• Ref 4: [Expression of microRNA-100 and its correlation with drug resistance in human ovarian cancer SKOV3/DDP cells]. Nan Fang Yi Ke Da Xue Xue Bao. 2015 Nov;35(11):1624-7.
• Ref 5: MicroRNA-100 resensitizes resistant chondrosarcoma cells to cisplatin through direct targeting of mTOR. Asian Pac J Cancer Prev. 2014;15(2):917-23. doi: 10.7314/apjcp.2014.15.2.917.
• Ref 6: MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1. Cancer Lett. 2012 Apr 28;317(2):184-91. doi: 10.1016/j.canlet.2011.11.024. Epub 2011 Nov 25.
• Ref 7: MicroRNA-100 suppresses human osteosarcoma cell proliferation and chemo-resistance via ZNRF2. Oncotarget. 2017 May 23;8(21):34678-34686. doi: 10.18632/oncotarget.16149.
• Ref 8: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 9: MicroRNA 100 sensitizes luminal A breast cancer cells to paclitaxel treatment in part by targeting mTOR. Oncotarget. 2016 Feb 2;7(5):5702-14. doi: 10.18632/oncotarget.6790.
• Ref 10: Overcoming melanoma resistance to vemurafenib by targeting CCL2-induced miR-34a, miR-100 and miR-125b. Oncotarget. 2016 Jan 26;7(4):4428-41. doi: 10.18632/oncotarget.6599.
• Ref 11: MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leuk Res. 2013 Oct;37(10):1315-21. doi: 10.1016/j.leukres.2013.06.027. Epub 2013 Jul 31.