Molecule Information

General Information of the Molecule (ID: Mol01353)

• Name: hsa-mir-31 ,Homo sapiens
• Synonyms: microRNA 31
• Molecule Type: Precursor miRNA
• Gene Name: MIR31
• Gene ID: 407035
• Location: chr9:21512115-21512185[-]
• Sequence:
  GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUU
  GCCAUCUUUCC
• Ensembl ID: ENSG00000199177
• HGNC ID: HGNC:31630
• Precursor Accession: MI0000089

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 11 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: LTEP-a-2 cells; Lung; Homo sapiens (Human); CVCL_6929
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-31 is inversely correlated with ABCB9 expression in NSCLC cells. ABCB9 is a direct target of miR-31. Ectopic expression of miR-31 confers DDP-induced apoptosis. Inhibition of ABCB9 is required for DDP resistance.

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vitro Model: 22RV1 cells; Prostate; Homo sapiens (Human); CVCL_1045
• In Vitro Model: VCaP cells; Prostate; Homo sapiens (Human); CVCL_2235
• In Vitro Model: WPE1-NA22 cells; Prostate; Homo sapiens (Human); CVCL_3810
• In Vitro Model: WPE1-NB11 cells; Prostate; Homo sapiens (Human); CVCL_3811
• In Vitro Model: WPE1-NB14 cells; Prostate; Homo sapiens (Human); CVCL_3812
• In Vitro Model: WPE1-NB26 cells; Prostate; Homo sapiens (Human); CVCL_3813
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-205 and miR-31 regulate apoptosis in prostate cancer cells by targeting antiapoptotic proteins Bcl-w and E2F6.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gallbladder cancer [ICD-11: 2C13.0] [3]

• Sensitive Disease: Gallbladder cancer [ICD-11: 2C13.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR31/Src/AKT/Bax/BCL2 signaling pathway; Inhibition; hsa05206
• In Vitro Model: GBC-SD cells; Gallbladder; Homo sapiens (Human); CVCL_6903
• In Vitro Model: NOZ cells; Gallbladder; Homo sapiens (Human); CVCL_3079
• In Vitro Model: GBC-SD/DDP cells; Gallbladder; Homo sapiens (Human); CVCL_6903
• In Vitro Model: NOZ/DDP cells; Gallbladder; Homo sapiens (Human); CVCL_3079
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony forming assay
• Mechanism Description: miR31 regulates the cisplatin resistance by targeting Src in gallbladder cancer The Src/Akt/Bax/Bcl-2 signaling cascade could be activated in the miR31-downregulated DDP-resistant GBC cells, and downregulation of Src sensitized the miR31 expressing GBC cells to DDP.

Dacarbazine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [ICD-11: 2C30.0] [4]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Dacarbazine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: HT144 cells; Skin; Homo sapiens (Human); CVCL_0318
• In Vitro Model: SkMEL5 cells; Skin; Homo sapiens (Human); CVCL_0527
• In Vitro Model: SkMEL1 cells; Skin; Homo sapiens (Human); CVCL_0068
• In Vitro Model: A2058 cells; Skin; Homo sapiens (Human); CVCL_1059
• In Vitro Model: A875 cells; Skin; Homo sapiens (Human); CVCL_4733
• In Vitro Model: M21 cells; Skin; Homo sapiens (Human); CVCL_D031
• In Vitro Model: SkMEL13 cells; Skin; Homo sapiens (Human); CVCL_6022
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-31 could suppress tumor growth and enhance sensitivity to dacarbazine (DTIC) by down-regulating SOX10 mainly via inhibiting PI3k/AkT signaling pathway in melanoma.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: RWPE-1 cells; Prostate; Homo sapiens (Human); CVCL_3791
• In Vitro Model: 22RV1 cells; Prostate; Homo sapiens (Human); CVCL_1045
• In Vitro Model: VCaP cells; Prostate; Homo sapiens (Human); CVCL_2235
• In Vitro Model: WPE1-NA22 cells; Prostate; Homo sapiens (Human); CVCL_3810
• In Vitro Model: WPE1-NB11 cells; Prostate; Homo sapiens (Human); CVCL_3811
• In Vitro Model: WPE1-NB14 cells; Prostate; Homo sapiens (Human); CVCL_3812
• In Vitro Model: WPE1-NB26 cells; Prostate; Homo sapiens (Human); CVCL_3813
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-205 and miR-31 regulate apoptosis in prostate cancer cells by targeting antiapoptotic proteins Bcl-w and E2F6.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Chemoresistance; Inhibition; hsa05207
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Celltiter glo assay
• Mechanism Description: We identified protein kinase C epsilon (PkC encoded by the PRkCE gene) as a novel direct target of miR-31 and show that down-regulation of PkC results in impaired NF-kB signaling, enhanced apoptosis, and increased sensitivity of MCF10A breast epithelial and MDA-MB-231 triple-negative breast cancer cells toward ionizing radiation as well as treatment with chemotherapeutics.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [8]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue dye-exclusion assay
• Mechanism Description: The increased expression level of miR-31 caused 5-FU resistance in colorectal cancer through silencing FIH-1, which is associated with cancer-specific energy metabolism.

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [9]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Function; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT116/5-FU cells; Colon; Homo sapiens (Human); CVCL_AU09
• In Vitro Model: LOVO/5-FU cells; Colon; Homo sapiens (Human); CVCL_0399
• Experiment for Molecule Alteration: RNA immunoprecipitation (RIP) assay; Dual-luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Knockdown of miR31 increased the 5-FU sensitivity of CRC cells at least partly by upregulation of apoptosis. Overexpression of ENST00000547547 suppressed the anti-apoptotic effect of miR31 via competitive binding to it. ENST00000547547 reduces the 5-FU resistance via competitive binding to miR31 in CRC cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [9]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HCT116/5-FU cells; Colon; Homo sapiens (Human); CVCL_AU09
• In Vitro Model: LOVO/5-FU cells; Colon; Homo sapiens (Human); CVCL_0399
• Experiment for Molecule Alteration: RNA immunoprecipitation (RIP) assay; Dual-luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: ABCB9 is a transporter which was reported to be targeted by miR31, involved in cisplatin-induced apoptosis, thus knockdown of miR31 increases the 5-FU sensitivity of CRC cell lines. ENST00000547547 reduces the 5-FU resistance via competitive binding to miR31.

Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [10]

• Sensitive Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Induction of miR31 in MkN-45 followed by suppression of RhoA expression resulted in increased sensitivity to 5-fluorouracil, inhibition of cell proliferation, and invasion compared to the control groups.

Disease Class: Gastric adenocarcinoma [ICD-11: 2B72.0] [11]

• Sensitive Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: MkN-45-miR-31 showed an increased sensitivity to 5-FU, decreased migration and cell invasion compared to the control groups and induction of miR-31 expression in MkN-45 caused a significant reduction of E2F6 and SMUG1 genes.

Disease Class: Gastric cancer [ICD-11: 2B72.1] [12]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: SNU-1 cells; Gastric; Homo sapiens (Human); CVCL_0099
• In Vitro Model: SNU-5 cells; Gastric; Homo sapiens (Human); CVCL_0078
• In Vitro Model: SNU-16 cells; Gastric; Homo sapiens (Human); CVCL_0076
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-31 triggers G 2/M cell cycle arrest, enhances the chemosensitivity and inhibits migration and invasion of human gastric cancer cells by downregulating the expression of zeste homolog 2 (ZH2).

Mitomycin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder urothelial carcinoma [ICD-11: 2C94.2] [13]

• Sensitive Disease: Bladder urothelial carcinoma [ICD-11: 2C94.2]
• Sensitive Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-31 expression brings about (+) sensitivity of UBC to MMC by suppressing ITGA5 and downstream pathways.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [14]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: FOXC1/miR31-5p/LATS2 pathway; Regulation; N.A.
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Microarray array analysis; Western blot; RT-qPCR; Luciferase Reporter Assay
• Experiment for Drug Resistance: MTT assay; TUNEL Assay
• Mechanism Description: Importantly, we reveal a novel drug-resistance mechanism in which the transcription factor FOXC1 binds to the miR-31 promoter to increase the expression of miR31-5p and regulate LATS2 expression, resulting in cancer cell resistance to OXA. These results suggest that miR-31-5p may be a novel biomarker involved in drug resistance progression in CRC patients. Moreover, the FOXC1/miR31-5p/LATS2 drug-resistance mechanism provides new treatment strategies for CRC in clinical trials.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [15]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [16]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [15]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [17]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: MicroRNA-31 inhibits cisplatin-induced apoptosis in non-small cell lung cancer cells by regulating the drug transporter ABCB9. Cancer Lett. 2014 Feb 28;343(2):249-57. doi: 10.1016/j.canlet.2013.09.034. Epub 2013 Oct 4.
• Ref 2: Downregulation of miR-205 and miR-31 confers resistance to chemotherapy-induced apoptosis in prostate cancer cells. Cell Death Dis. 2010 Dec 9;1(12):e105. doi: 10.1038/cddis.2010.85.
• Ref 3: MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer. Oncotarget. 2016 Dec 13;7(50):83060-83070. doi: 10.18632/oncotarget.13067.
• Ref 4: The miR-31-SOX10 axis regulates tumor growth and chemotherapy resistance of melanoma via PI3K/AKT pathway. Biochem Biophys Res Commun. 2018 Sep 18;503(4):2451-2458. doi: 10.1016/j.bbrc.2018.06.175. Epub 2018 Jul 3.
• Ref 5: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 6: MicroRNA-31 sensitizes human breast cells to apoptosis by direct targeting of protein kinase C epsilon (PKCepsilon). J Biol Chem. 2013 Mar 22;288(12):8750-8761. doi: 10.1074/jbc.M112.414128. Epub 2013 Jan 30.
• Ref 7: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 8: Induced miR-31 by 5-fluorouracil exposure contributes to the resistance in colorectal tumors. Cancer Sci. 2019 Aug;110(8):2540-2548. doi: 10.1111/cas.14090. Epub 2019 Jul 23.
• Ref 9: The long non-coding RNA ENST00000547547 reduces 5-fluorouracil resistance of colorectal cancer cells via competitive binding to microRNA-31. Oncol Rep. 2018 Jan;39(1):217-226. doi: 10.3892/or.2017.6082. Epub 2017 Nov 7.
• Ref 10: MicroRNA-31 inhibits RhoA-mediated tumor invasion and chemotherapy resistance in MKN-45 gastric adenocarcinoma cells. Exp Biol Med (Maywood). 2017 Dec;242(18):1842-1847. doi: 10.1177/1535370217728460. Epub 2017 Aug 24.
• Ref 11: Induction of miR-31 causes increased sensitivity to 5-FU and decreased migration and cell invasion in gastric adenocarcinoma. Bratisl Lek Listy. 2019;120(1):35-39. doi: 10.4149/BLL_2019_005.
• Ref 12: MicroRNA-31 triggers G(2)/M cell cycle arrest, enhances the chemosensitivity and inhibits migration and invasion of human gastric cancer cells by downregulating the expression of zeste homolog 2 (ZH2). Arch Biochem Biophys. 2019 Mar 15;663:269-275. doi: 10.1016/j.abb.2019.01.023. Epub 2019 Jan 21.
• Ref 13: MicroRNA-31 functions as a tumor suppressor and increases sensitivity to mitomycin-C in urothelial bladder cancer by targeting integrin Alpha5. Oncotarget. 2016 May 10;7(19):27445-57. doi: 10.18632/oncotarget.8479.
• Ref 14: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.
• Ref 15: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 16: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 17: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.