Molecule Information

General Information of the Molecule (ID: Mol01340)
Name
hsa-mir-19a ,Homo sapiens
Synonyms
microRNA 19a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR19A
Gene ID
406979
Location
chr13:91350891-91350972[+]
Sequence
GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUA
UGCAAAACUGAUGGUGGCCUGC
    Click to Show/Hide
Ensembl ID
ENSG00000284204
HGNC ID
HGNC:31574
Precursor Accession
MI0000073
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
12 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
PTEN/AKT signaling pathway Activation hsa05235
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Deregulation of LncRNA-AC078883.3 and microRNA-19a is involved in the development of chemoresistance to cisplatin via modulating signaling pathway of PTEN/AkT.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
BGC823 cells Gastric Homo sapiens (Human) CVCL_3360
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Down-regulation of CASC2 contributes to cisplatin resistance in gastric cancer by elevating miR-19a expression.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Epirubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Breast cancer patients Homo sapiens
Experiment for
Molecule Alteration		 TaqMan Real-time PCR microRNA Array
Mechanism Description After being analyzed, 8 miRNAs satisfied the criteria. Of those 8 miRNAs, 6 were up-regulated and 2 were down-regulated in the resistant group compared with the sensitive group.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Response evaluation criteria in solid tumors assay
Mechanism Description Aberrant expression of serum miR-19a in FOLFOX chemotherapy resistance patients, suggesting serum miR-19a could be a potential molecular biomarker for predicting and monitoring resistance to first-line FOLFOX chemotherapy regimens in advanced colorectal cancer patients.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [6]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Epithelial mesenchymal transition signaling pathway Inhibition hsa01521
miR19a/c-Met signaling pathway Regulation N.A.
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
A549 cells Lung Homo sapiens (Human) CVCL_0023
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
PC9 cells Lung Homo sapiens (Human) CVCL_B260
PC9GR cells Lung Homo sapiens (Human) CVCL_V337
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR19a contributes to gefitinib resistance and epithelial mesenchymal transition in non-small cell lung cancer cells by targeting c-Met. Overexpression of miR19a decreased c-Met expression and re-sensitized gefitinib-resistant NSCLC cells in vitro and in vivo. Decreased miR19a expression may contribute to NSCLC cell metastasis by increasing cell mobility and migration and promoting EMT.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [7]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
RT4 cells Bladder Homo sapiens (Human) CVCL_0036
RT112 cells Bladder Homo sapiens (Human) CVCL_1670
Experiment for
Molecule Alteration		 Western blot; Microarray Analysis; qRT-PCR
Experiment for
Drug Resistance		 Proliferation Assay
Mechanism Description Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells
Leucovorin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Leucovorin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Response evaluation criteria in solid tumors assay
Mechanism Description Aberrant expression of serum miR-19a in FOLFOX chemotherapy resistance patients, suggesting serum miR-19a could be a potential molecular biomarker for predicting and monitoring resistance to first-line FOLFOX chemotherapy regimens in advanced colorectal cancer patients.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Response evaluation criteria in solid tumors assay
Mechanism Description Aberrant expression of serum miR-19a in FOLFOX chemotherapy resistance patients, suggesting serum miR-19a could be a potential molecular biomarker for predicting and monitoring resistance to first-line FOLFOX chemotherapy regimens in advanced colorectal cancer patients.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Breast cancer patients Homo sapiens
Experiment for
Molecule Alteration		 TaqMan Real-time PCR microRNA Array
Mechanism Description After being analyzed, 8 miRNAs satisfied the criteria. Of those 8 miRNAs, 6 were up-regulated and 2 were down-regulated in the resistant group compared with the sensitive group.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [8]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration		 Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [9]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
References
Ref 1 Deregulation of lncRNA-AC078883.3 and microRNA-19a is involved in the development of chemoresistance to cisplatin via modulating signaling pathway of PTEN/AKT. J Cell Physiol. 2019 Dec;234(12):22657-22665. doi: 10.1002/jcp.28832. Epub 2019 May 20.
Ref 2 Down-regulation of CASC2 contributes to cisplatin resistance in gastric cancer by sponging miR-19a. Biomed Pharmacother. 2018 Dec;108:1775-1782. doi: 10.1016/j.biopha.2018.09.181. Epub 2018 Oct 16.
Ref 3 MicroRNA-19a/b regulates multidrug resistance in human gastric cancer cells by targeting PTEN. Biochem Biophys Res Commun. 2013 May 10;434(3):688-94. doi: 10.1016/j.bbrc.2013.04.010. Epub 2013 Apr 16.
Ref 4 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 5 Serum miR-19a predicts resistance to FOLFOX chemotherapy in advanced colorectal cancer cases. Asian Pac J Cancer Prev. 2013;14(12):7421-6. doi: 10.7314/apjcp.2013.14.12.7421.
Ref 6 miR-19a contributes to gefitinib resistance and epithelial mesenchymal transition in non-small cell lung cancer cells by targeting c-Met. Sci Rep. 2017 Jun 7;7(1):2939. doi: 10.1038/s41598-017-01153-0.
Ref 7 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 8 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
Ref 9 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.