Molecule Information

General Information of the Molecule (ID: Mol01340)

• Name: hsa-mir-19a ,Homo sapiens
• Synonyms: microRNA 19a
• Molecule Type: Precursor miRNA
• Gene Name: MIR19A
• Gene ID: 406979
• Location: chr13:91350891-91350972[+]
• Sequence:
  GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUA
  UGCAAAACUGAUGGUGGCCUGC
• Ensembl ID: ENSG00000284204
• HGNC ID: HGNC:31574
• Precursor Accession: MI0000073

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Activation; hsa05235
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Deregulation of LncRNA-AC078883.3 and microRNA-19a is involved in the development of chemoresistance to cisplatin via modulating signaling pathway of PTEN/AkT.

Disease Class: Gastric cancer [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Down-regulation of CASC2 contributes to cisplatin resistance in gastric cancer by elevating miR-19a expression.

Disease Class: Gastric cancer [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Inhibition; hsa05235
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Inhibition; hsa05235
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Response evaluation criteria in solid tumors assay
• Mechanism Description: Aberrant expression of serum miR-19a in FOLFOX chemotherapy resistance patients, suggesting serum miR-19a could be a potential molecular biomarker for predicting and monitoring resistance to first-line FOLFOX chemotherapy regimens in advanced colorectal cancer patients.

Disease Class: Gastric cancer [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Inhibition; hsa05235
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [5]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• Cell Pathway Regulation: miR19a/c-Met signaling pathway; Regulation; hsa05206
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: PC9GR cells; Lung; Homo sapiens (Human); CVCL_V337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR19a contributes to gefitinib resistance and epithelial mesenchymal transition in non-small cell lung cancer cells by targeting c-Met. Overexpression of miR19a decreased c-Met expression and re-sensitized gefitinib-resistant NSCLC cells in vitro and in vivo. Decreased miR19a expression may contribute to NSCLC cell metastasis by increasing cell mobility and migration and promoting EMT.

Leucovorin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Leucovorin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Response evaluation criteria in solid tumors assay
• Mechanism Description: Aberrant expression of serum miR-19a in FOLFOX chemotherapy resistance patients, suggesting serum miR-19a could be a potential molecular biomarker for predicting and monitoring resistance to first-line FOLFOX chemotherapy regimens in advanced colorectal cancer patients.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Response evaluation criteria in solid tumors assay
• Mechanism Description: Aberrant expression of serum miR-19a in FOLFOX chemotherapy resistance patients, suggesting serum miR-19a could be a potential molecular biomarker for predicting and monitoring resistance to first-line FOLFOX chemotherapy regimens in advanced colorectal cancer patients.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Inhibition; hsa05235
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.

References

• Ref 1: Deregulation of lncRNA-AC078883.3 and microRNA-19a is involved in the development of chemoresistance to cisplatin via modulating signaling pathway of PTEN/AKT. J Cell Physiol. 2019 Dec;234(12):22657-22665. doi: 10.1002/jcp.28832. Epub 2019 May 20.
• Ref 2: Down-regulation of CASC2 contributes to cisplatin resistance in gastric cancer by sponging miR-19a. Biomed Pharmacother. 2018 Dec;108:1775-1782. doi: 10.1016/j.biopha.2018.09.181. Epub 2018 Oct 16.
• Ref 3: MicroRNA-19a/b regulates multidrug resistance in human gastric cancer cells by targeting PTEN. Biochem Biophys Res Commun. 2013 May 10;434(3):688-94. doi: 10.1016/j.bbrc.2013.04.010. Epub 2013 Apr 16.
• Ref 4: Serum miR-19a predicts resistance to FOLFOX chemotherapy in advanced colorectal cancer cases. Asian Pac J Cancer Prev. 2013;14(12):7421-6. doi: 10.7314/apjcp.2013.14.12.7421.
• Ref 5: miR-19a contributes to gefitinib resistance and epithelial mesenchymal transition in non-small cell lung cancer cells by targeting c-Met. Sci Rep. 2017 Jun 7;7(1):2939. doi: 10.1038/s41598-017-01153-0.