Molecule Information
General Information of the Molecule (ID: Mol01328)
| Name |
hsa-let-7a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA let-7a-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
HCCAT1, LINC00078, NCRNA00078
|
||||
| Gene ID | |||||
| Location |
chr9:94175957-94176036[+]
|
||||
| Sequence |
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAU
ACAAUCUACUGUCUUUCCUA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [1] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
| SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Let-7a enhances the sensitivity of hepatocellular carcinoma cells to cetuximab by negatively regulating STAT3 expression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [2] | |||
| Resistant Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell cytotoxicity | Inhibition | hsa04650 | |
| Tumorigenesis | Activation | hsa05206 | ||
| In Vitro Model | 5-8F cells | Nasopharynx | Homo sapiens (Human) | CVCL_C528 |
| CNE2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6889 | |
| CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 | |
| HONE1 cells | Throat | Homo sapiens (Human) | CVCL_8706 | |
| NP69 cells | Nasopharynx | Homo sapiens (Human) | CVCL_F755 | |
| S18 cells | Nasopharynx | Homo sapiens (Human) | CVCL_B0U9 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
Luciferase reporter assay; RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V-FITC apoptosis assay | |||
| Mechanism Description | ANRIL directly interacts with let-7a and regulates its expression, ANRIL could directly bind to let-7a and negatively regulate let-7a expression. Down-regulation of LncRNA ANRIL represses tumorigenicity and enhances cisplatin-induced cytotoxicity via regulating microRNA let-7a in nasopharyngeal carcinoma. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] | [3] | |||
| Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
| Sensitive Drug | Cytarabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell growth | Activation | hsa05200 | |
| Cell invasion | Activation | hsa05200 | ||
| Epithelial mesenchymal transition signaling pathway | Activation | hsa01521 | ||
| In Vitro Model | Molm13 cells | Blood | Homo sapiens (Human) | CVCL_2119 |
| OCI-AML3 cells | Blood | Homo sapiens (Human) | CVCL_1844 | |
| In Vivo Model | AML nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Xenografts of primary human AML cells engineered to overexpress let-7a exhibited enhanced sensitivity to cytarabine. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast adenocarcinoma [ICD-11: 2C60.1] | [4] | |||
| Resistant Disease | Breast adenocarcinoma [ICD-11: 2C60.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [4] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Disease Class: Cutaneous squamous cell carcinoma [ICD-11: 2C31.1] | [4] | |||
| Resistant Disease | Cutaneous squamous cell carcinoma [ICD-11: 2C31.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | A431 cells | Skin | Homo sapiens (Human) | CVCL_0037 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| Redox signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| WM239 cells | Breast | Homo sapiens (Human) | CVCL_6795 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Let-7a represses proliferation and clonogenic capacity of MDA-MB-231 cells. Let-7a down-regulates key anabolic enzymes in MDA-MB-231 cells. Let-7a regulates energy metabolism and mitochondrial ROS in MDA-MB-231 cells. Let-7a regulates mitochondrial ROS in WM239 melanoma cells. Let-7a sensitizes breast cancer and melanoma cells to doxorubicin. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [6] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Epirubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Lower let-7a expression was associated with epirubicin resistance in primary breast tumors. Moreover, upregulation of let-7a expression sensitized resistant breast tumor cell lines to epirubicin by enhancing cellular apoptosis in vitro. Collectively, these findings indicate that lower expression of let-7a miRNA can induce chemoresistance in breast cancer by enhancing cellular apoptosis and suggest that let-7a may be used as a therapeutic target to modulate epirubicin-based chemotherapy resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [7] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Transwell assays and wound healing assay; Flow cytometry assay | |||
| Mechanism Description | ANRIL promotes chemoresistance via disturbing expression of ABCC1 by inhibiting the expression of Let-7a in colorectal cancer. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [8] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | CXCR4/let-7a/HMGA2 pathway | Regulation | N.A. | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HPDE6-C7 cells | Pancreas | Homo sapiens (Human) | CVCL_0P38 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Transwell assay; Flow cytometric analysis | |||
| Mechanism Description | CXCR4/Let-7a axis regulates metastasis and chemoresistance of pancreatic cancer cells through targeting HMGA2. overexpression of HMGA2 restores cell proliferation, metastasis and chemosensitivity of gem inhibited by let-7a. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast adenocarcinoma [ICD-11: 2C60.1] | [4] | |||
| Resistant Disease | Breast adenocarcinoma [ICD-11: 2C60.1] | |||
| Resistant Drug | Lamivudine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [4] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Lamivudine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Disease Class: Cutaneous squamous cell carcinoma [ICD-11: 2C31.1] | [4] | |||
| Resistant Disease | Cutaneous squamous cell carcinoma [ICD-11: 2C31.1] | |||
| Resistant Drug | Lamivudine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | A431 cells | Skin | Homo sapiens (Human) | CVCL_0037 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [7] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Transwell assays and wound healing assay; Flow cytometry assay | |||
| Mechanism Description | ANRIL promotes chemoresistance via disturbing expression of ABCC1 by inhibiting the expression of Let-7a in colorectal cancer. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast adenocarcinoma [ICD-11: 2C60.1] | [4] | |||
| Resistant Disease | Breast adenocarcinoma [ICD-11: 2C60.1] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [4] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
| Disease Class: Cutaneous squamous cell carcinoma [ICD-11: 2C31.1] | [4] | |||
| Resistant Disease | Cutaneous squamous cell carcinoma [ICD-11: 2C31.1] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | A431 cells | Skin | Homo sapiens (Human) | CVCL_0037 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
