Molecule Information

General Information of the Molecule (ID: Mol01383)

• Name: hsa-mir-181a ,Homo sapiens
• Synonyms: microRNA 181a-2
• Molecule Type: Precursor miRNA
• Gene Name: MIR181A2
• Gene ID: 406954
• Location: chr9:124692442-124692551[+]
• Sequence:
  AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAG
  UUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA
• Ensembl ID: ENSG00000207595
• HGNC ID: HGNC:31549
• Precursor Accession: MI0000269

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 14 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical squamous cell carcinoma [2]

• Resistant Disease: Cervical squamous cell carcinoma [ICD-11: 2C77.3]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: ME-180 cells; Uterus; Homo sapiens (Human); CVCL_1401
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The down-regulation of PRkCD expression may be a molecular mechanism through which miR-181a exerts its functions as an oncogene and an enhancer of chemoresistance to cisplatin in cervical squamous cell carcinoma cells.

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SGC7901/CDDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-181a inhibited autophagy in cisplatin-resistant cell line SGC7901/CDDP. ATG5 was a potential target of miR-181a. miR-181a sensitized SGC7901/CDDP cells to cisplatin in vivo and in vitro.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Tongue squamous cell carcinoma [4]

• Sensitive Disease: Tongue squamous cell carcinoma [ICD-11: 2B62.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: miR181a-Twist1 signaling pathway; Regulation; hsa05206
• In Vitro Model: CAL27 cells; Oral; Homo sapiens (Human); CVCL_1107
• In Vitro Model: SCC15 cells; Tongue; Homo sapiens (Human); CVCL_1681
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Cisplatin chemoresistance induced EMT, enhanced metastatic potential and down-regulated miR-181a in TSCC cells, miR-181a directly targeted Twist1 and then reversed chemoresistance and EMT in TSCC cells, miR-181a-Twist1 pathway may play an important role in the development of cisplatin-chemoresistance.

Cytarabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [5]

• Sensitive Disease: Leukemia [ICD-11: 2B33.6]
• Sensitive Drug: Cytarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: HL-60/Ara-C-resistant cells; Blood; Homo sapiens (Human); CVCL_1736
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Bcl-2 was conWrmed as adirect miR-181a target by immunoblot analysis andreporter gene assays. knockdown of Bcl-2 mimicked theeVect of enforced miR-181a expression by reducing cellviability. In addition, the apoptosis pathway was activated by cytochrome C release and caspase 9/caspase 3 activationafter miR-181a overexpression. Down-regulation of miR-181a and upregulation of Bcl-2in leukaemia cells confer resistance to Ara-C-based ther-apy.

Daunorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [6]

• Sensitive Disease: Leukemia [ICD-11: 2B33.6]
• Sensitive Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: K562/A02 cells; Blood; Homo sapiens (Human); CVCL_0368
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Anti-apoptotic BCL-2 contributes to the survival and chemoresistance of quiescent leukemia CD34+ cells, leukemia cells with decreased miR-181a expression and elevated BCL-2 protein expression were more resistant to DNR than the control cells.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [7]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: C4-2B cells; Prostate; Homo sapiens (Human); CVCL_4784
• In Vitro Model: TaxR cells; Prostate; Homo sapiens (Human); CVCL_4V97
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Beckman Coulter method; Rhodamine Assay; Cell Death ELISA
• Mechanism Description: Overexpression of miR181a in prostate cancer cells contributes to their resistance to docetaxel, this is due, in part, to modulation of p53 phosphorylation and apoptosis.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-181a played an important role in chemosensitivity to adriamycin in MCF-7 and MCF-7/ADR cells via targeting Bcl-2.

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Fludarabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic lymphocytic leukemia [9]

• Resistant Disease: Chronic lymphocytic leukemia [ICD-11: 2A82.0]
• Resistant Drug: Fludarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: High levels of miR-181a and miR-221 also point to cell cycle progression as both miRNAs repress CDkN1B (p27) expression in hematologic diseases and p27 was also found down-regulated in resistant cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic lymphocytic leukemia [10]

• Sensitive Disease: Chronic lymphocytic leukemia [ICD-11: 2A82.0]
• Sensitive Drug: Fludarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: CLL B cells; Lymph; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-181a and miR-181b directly inhibit the expression of BCL-2, MCL-1 and XIAP by binding to the target sequence, sensitizes CLL cells to fludarabine-induced apoptosis.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [11]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Regulation; hsa04010
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: PC9GR cells; Lung; Homo sapiens (Human); CVCL_V337
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Down-regulation of GAS7 expression could antagonize gefitinib re-sensitivity in PC9GR mediated by knockdown of miR181a via AkT/ERk pathways and epithelial-to-mesenchymal transition markers.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Mitoxantrone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [12]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Mitoxantrone
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-181a down-regulated BCRP expression, and sensitized MX-resistant MCF-7/MX cells to MX.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [13]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-181a level in chemoresistant (CR) cancer tissues were significantly higher than in chemosensitive (CS) cancer tissues and in normal tissue. SkOV3/PTX cells had significantly higher expression of miR-181a and N-cadherin than SkOV3 cells. SkOV3 cells had decreased E-cadherin expression and increased N-cadherin expression after enforced miR-181a expression, while SkOV3/PTX cells had increased E-cadherin expression and decreased N-cadherin expression after miR-181a knockdown. SkOV3 cells had increased P-gp expression after enforced miR-181a expression. Following MTT assay and flow cytometry analysis both confirmed that miR-181a overexpression decreased the PTX sensitivity of SkOV3 cells and while miR-181a inhibition increased the sensitivity of SkOV3/PTX cells. miR-181a is an important oncomiR significantly increased in chemoresistant ovarian cancer. Its upregulation is associated with increased level of EMT and decreased cell apoptosis induced by PTX treatment.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [14]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: CCAT1/miR181a/CPEB2 signaling pathway; Regulation; hsa05206
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: LncRNA CCAT1 regulates the sensitivity of paclitaxel in NPC cells via miR181a/CPEB2 axis. miR181a restores CCAT1-induced paclitaxel resistant in NPC cells via targeting CPEB2.

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [15]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: MAPK signaling pathway; Inhibition; hsa04010
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase 3/7 activity analysis; CCK8 assay
• Mechanism Description: miR-181a induces sorafenib resistance of hepatocellular carcinoma cells through downregulation of RASSF1 expression.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [16]

• Resistant Disease: Malignant glioma [ICD-11: 2A00.2]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: U373 cells; Brain; Homo sapiens (Human); CVCL_2219
• In Vitro Model: U118 cells; Brain; Homo sapiens (Human); CVCL_0633
• In Vitro Model: NHA cells; Brain; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; BrdU incorporation assay
• Mechanism Description: LncRNA CASC2 interacts with miR181a to modulate glioma growth and resistance to TMZ through PTEN pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [16]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PTEN signaling pathway; Activation; hsa05235
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: U373 cells; Brain; Homo sapiens (Human); CVCL_2219
• In Vitro Model: U118 cells; Brain; Homo sapiens (Human); CVCL_0633
• In Vitro Model: NHA cells; Brain; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; BrdU incorporation assay
• Mechanism Description: CASC2 up-regulated PTEN protein and down-regulated p-AkT protein through regulating miR181a, and the effect of CASC2 on PTEN and p-AkT could be partially restored by miR181a.

Disease Class: Glioblastoma [17]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Clinical Trial Drug(s) 2 drug(s) in total

Camptothecin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [18]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Camptothecin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: CCRF-CEM cells; Pleural effusion; Homo sapiens (Human); CVCL_0207
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Abnormal high expression of miR-181a in bone marrow and Cim-C1 cells in ALL children, inhibition of Mir-181A expression in Cim-C1 cells can significantly increase drug sensitivity of CIM-C1 cells, and upregulation of Mir-181A expression in CCRF-CEM cells can significantly increase drug resistance of CCRF-CEM cells.

Trichostatin A

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder carcinoma [19]

• Resistant Disease: Bladder carcinoma [ICD-11: 2C94.1]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Disease Class: Adult acute myeloid leukemia [19]

• Resistant Disease: Adult acute myeloid leukemia [ICD-11: 2A60.1]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Disease Class: Colon carcinoma [19]

• Resistant Disease: Colon carcinoma [ICD-11: 2B90.2]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Disease Class: Prostate cancer [19]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Trichostatin A
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: C4-2B cells; Prostate; Homo sapiens (Human); CVCL_4784
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.

Investigative Drug(s) 1 drug(s) in total

Platinum

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [20]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Platinum
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: TGF-beta signaling pathway; Activation; hsa04350
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenicity assay; Cell migration and invasion assay
• Mechanism Description: Smad7 is a direct functional target of miR-181a. There is a striking inverse correlation between miR-181a and Smad7 expression. enhanced miR-181a expression resulted in the activation of other Smad-dependent protein such as TGF-beta R1 and potentially non-canonical TGF-beta-related pathways. By this mechanism the TGF-beta pathway is activated in ovarian cancer tumours and contributes to poor patient outcome.

References

• Ref 1: Differential miRNA expression profiles in hepatocellular carcinoma cells and drug-resistant sublines. Oncol Rep. 2013 Feb;29(2):555-62. doi: 10.3892/or.2012.2155. Epub 2012 Nov 28.
• Ref 2: MicroRNA-181a enhances the chemoresistance of human cervical squamous cell carcinoma to cisplatin by targeting PRKCD. Exp Cell Res. 2014 Jan 1;320(1):12-20. doi: 10.1016/j.yexcr.2013.10.014. Epub 2013 Oct 31.
• Ref 3: MiR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin. Gene. 2016 Feb 1;576(2 Pt 2):828-33. doi: 10.1016/j.gene.2015.11.013. Epub 2015 Nov 14.
• Ref 4: miR-181a-Twist1 pathway in the chemoresistance of tongue squamous cell carcinoma. Biochem Biophys Res Commun. 2013 Nov 15;441(2):364-70. doi: 10.1016/j.bbrc.2013.10.051. Epub 2013 Oct 19.
• Ref 5: miR-181a sensitizes resistant leukaemia HL-60/Ara-C cells to Ara-C by inducing apoptosis. J Cancer Res Clin Oncol. 2012 Apr;138(4):595-602. doi: 10.1007/s00432-011-1137-3. Epub 2012 Jan 1.
• Ref 6: miR-181a sensitizes a multidrug-resistant leukemia cell line K562/A02 to daunorubicin by targeting BCL-2. Acta Biochim Biophys Sin (Shanghai). 2012 Mar;44(3):269-77. doi: 10.1093/abbs/gmr128. Epub 2012 Jan 26.
• Ref 7: MicroRNA-181a promotes docetaxel resistance in prostate cancer cells. Prostate. 2017 Jun;77(9):1020-1028. doi: 10.1002/pros.23358.
• Ref 8: The function role of miR-181a in chemosensitivity to adriamycin by targeting Bcl-2 in low-invasive breast cancer cells. Cell Physiol Biochem. 2013;32(5):1225-37. doi: 10.1159/000354521. Epub 2013 Nov 14.
• Ref 9: Determination of genes and microRNAs involved in the resistance to fludarabine in vivo in chronic lymphocytic leukemia. Mol Cancer. 2010 May 20;9:115. doi: 10.1186/1476-4598-9-115.
• Ref 10: miR-181a/b significantly enhances drug sensitivity in chronic lymphocytic leukemia cells via targeting multiple anti-apoptosis genes. Carcinogenesis. 2012 Jul;33(7):1294-301. doi: 10.1093/carcin/bgs179. Epub 2012 May 18.
• Ref 11: MiR-181a contributes gefitinib resistance in non-small cell lung cancer cells by targeting GAS7. Biochem Biophys Res Commun. 2018 Jan 22;495(4):2482-2489. doi: 10.1016/j.bbrc.2017.12.096. Epub 2017 Dec 18.
• Ref 12: MiR-181a enhances drug sensitivity in mitoxantone-resistant breast cancer cells by targeting breast cancer resistance protein (BCRP/ABCG2). Breast Cancer Res Treat. 2013 Jun;139(3):717-30. doi: 10.1007/s10549-013-2607-x. Epub 2013 Jun 19.
• Ref 13: MiR-181a upregulation is associated with epithelial-to-mesenchymal transition (EMT) and multidrug resistance (MDR) of ovarian cancer cells. Eur Rev Med Pharmacol Sci. 2016 May;20(10):2004-10.
• Ref 14: LncRNA CCAT1 modulates the sensitivity of paclitaxel in nasopharynx cancers cells via miR-181a/CPEB2 axis. Cell Cycle. 2017 Apr 18;16(8):795-801. doi: 10.1080/15384101.2017.1301334. Epub 2017 Mar 30.
• Ref 15: miR-181a induces sorafenib resistance of hepatocellular carcinoma cells through downregulation of RASSF1 expression. Cancer Sci. 2016 Sep;107(9):1256-62. doi: 10.1111/cas.13006. Epub 2016 Sep 2.
• Ref 16: LncRNA CASC2 Interacts With miR-181a to Modulate Glioma Growth and Resistance to TMZ Through PTEN Pathway. J Cell Biochem. 2017 Jul;118(7):1889-1899. doi: 10.1002/jcb.25910. Epub 2017 Feb 13.
• Ref 17: miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells. Med Oncol. 2014 Apr;31(4):892. doi: 10.1007/s12032-014-0892-9. Epub 2014 Feb 27.
• Ref 18: [The expression and functional study of miR-181a in pediatric acute lymphoblastic leukemia]. Zhonghua Xue Ye Xue Za Zhi. 2015 Jan;36(1):53-7. doi: 10.3760/cma.j.issn.0253-2727.2015.01.013.
• Ref 19: miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer. Oncogene. 2013 Sep 26;32(39):4694-701. doi: 10.1038/onc.2012.483. Epub 2012 Oct 22.
• Ref 20: microRNA-181a has a critical role in ovarian cancer progression through the regulation of the epithelial-mesenchymal transition. Nat Commun. 2014;5:2977. doi: 10.1038/ncomms3977.