Molecule Information

General Information of the Molecule (ID: Mol05893)

• Name: hsa-miR-19b-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAA
  AUCCAUGCAAAACUGACUGUGGUAGUG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular cancer [.] [2]

• Resistant Disease: Testicular cancer [.]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-qPCR with "Low Density Array"
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR; Fluorescence intensity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Cell apoptosis assays
• Mechanism Description: Multidrug resistance (MDR) is the major cause of failure of gastric cancer chemotherapy. Members of the miR-17-92 cluster, including miR-19a/b, are considered oncomiRs and influence multiple aspects of the malignant phenotype of gastric cancer. However, the role of miR-19a/b in MDR in gastric cancer and its underlying mechanism remain unclear. In this study, we found that miR-19a/b were upregulated in MDR cell lines. Our results also showed that miR-19a/b upregulation decreased the sensitivity of gastric cancer cells to anticancer drugs. We further confirmed that miR-19a/b accelerated the ADR efflux of gastric cancer cells by increasing the levels of mdr1 and P-gp and that miR-19a/b suppressed drug-induced apoptosis by regulating Bcl-2 and Bax. Finally, we verified that PTEN, an inhibitor of AKT phosphorylation, is the functional target of miR-19a/b. Overall, these findings demonstrated that miR-19a/b promote MDR in gastric cancer cells by targeting PTEN.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 4: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.