Molecule Information

General Information of the Molecule (ID: Mol05677)

• Name: hsa-miR-300 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: UAUACAAGGGCAGACUCUCUCU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: TGF-beta signaling pathway, apoptosis pathway; Regulation; N.A.
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: CP70 cells; Ovary; Homo sapiens (Human); CVCL_0135
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cell viability assays
• Mechanism Description: Out of 11 miRNAs that showed differential expression, 5 were up-regulated and 6 were down regulated in A2780/CP70 cell line compared to A2780 cell line. Up-regulated miRNAs include hsa-miRplus-F1064, hsa-miR-300, hsa-miR-193b, hsa-miR-642, and hsa-miR-1299. Out of 11 miRNA, 6 were down-regulated: hsa-miR-625, hsa-miR-20b, hsa-miRPlus-F1147, hsa-let-7c, hsa-miRPlus-F1231, and hsa-miR-542-3p.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

References

• Ref 1: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 2: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 3: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.